Human EVL(Enah/Vasp Like Protein) ELISA Kit

Human EVL(Enah/Vasp Like Protein) ELISA Kit

Human Enah/Vasp Like Protein (EVL) ELISA Kit
RD-EVL-Hu-48Tests	Reddot Biotech	48 Tests	EUR 563

Human Enah/Vasp Like Protein (EVL) ELISA Kit
RD-EVL-Hu-96Tests	Reddot Biotech	96 Tests	EUR 783

Human Enah/Vasp Like Protein (EVL) ELISA Kit
20-abx151456	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Enah/Vasp Like Protein(EVL)ELISA Kit
QY-E04947	Qayee Biotechnology	96T	EUR 361

Human Enah/Vasp Like Protein (EVL) ELISA Kit
SEQ820Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5189.65
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Enah/Vasp Like Protein (EVL) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Enah/Vasp Like Protein (EVL) in tissue homogenates, cell lysates and other biological fluids.

Human Enah/Vasp Like Protein (EVL) ELISA Kit
SEQ820Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 515.03
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Enah/Vasp Like Protein (EVL) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Enah/Vasp Like Protein (EVL) in tissue homogenates, cell lysates and other biological fluids.

Human Enah/Vasp Like Protein (EVL) ELISA Kit
SEQ820Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 692.9
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Enah/Vasp Like Protein (EVL) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Enah/Vasp Like Protein (EVL) in tissue homogenates, cell lysates and other biological fluids.

Human Enah/Vasp Like Protein (EVL) ELISA Kit
SEQ820Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2818.05
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Enah/Vasp Like Protein (EVL) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Enah/Vasp Like Protein (EVL) in tissue homogenates, cell lysates and other biological fluids.

Human Enah/Vasp Like Protein (EVL) ELISA Kit
4-SEQ820Hu	Cloud-Clone	EUR 5240.00 EUR 2769.00 EUR 693.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Enah/Vasp Like Protein elisa. Alternative names of the recognized antigen: RNB6 Enabled/Vasodilator Stimulated Phosphoprotein Like protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Enah/Vasp Like Protein (EVL) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Enah/Vasp Like Protein (EVL) Antibody
20-abx176248	Abbexa	EUR 1316.00 EUR 620.00	1 mg 200 ug
Please enquire.

Enah/Vasp Like Protein (EVL) Antibody
20-abx112284	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Enah/Vasp Like Protein (EVL) Antibody
20-abx172219	Abbexa	EUR 926.00 EUR 467.00	1 mg 200 ug
Please enquire.

Human Enah/Vasp Like Protein (EVL) Protein
20-abx653258	Abbexa	EUR 648.00 EUR 272.00 EUR 1998.00 EUR 773.00 EUR 467.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Mouse Enah/Vasp Like Protein ELISA Kit (EVL)
RK02774	Abclonal	96 Tests	EUR 521

Mouse Enah/Vasp Like Protein (EVL) ELISA Kit
SEQ820Mu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5333.64
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Enah/Vasp Like Protein (EVL) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Enah/Vasp Like Protein (EVL) in tissue homogenates, cell lysates and other biological fluids.

Mouse Enah/Vasp Like Protein (EVL) ELISA Kit
SEQ820Mu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 526.89
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Enah/Vasp Like Protein (EVL) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Enah/Vasp Like Protein (EVL) in tissue homogenates, cell lysates and other biological fluids.

Mouse Enah/Vasp Like Protein (EVL) ELISA Kit
SEQ820Mu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 709.84
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Enah/Vasp Like Protein (EVL) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Enah/Vasp Like Protein (EVL) in tissue homogenates, cell lysates and other biological fluids.

Mouse Enah/Vasp Like Protein (EVL) ELISA Kit
SEQ820Mu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2894.28
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Enah/Vasp Like Protein (EVL) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Enah/Vasp Like Protein (EVL) in tissue homogenates, cell lysates and other biological fluids.

Mouse Enah/Vasp Like Protein (EVL) ELISA Kit
4-SEQ820Mu	Cloud-Clone	EUR 5384.00 EUR 2845.00 EUR 710.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Enah/Vasp Like Protein elisa. Alternative names of the recognized antigen: RNB6 Enabled/Vasodilator Stimulated Phosphoprotein Like protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Enah/Vasp Like Protein (EVL) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Enah/Vasp Like Protein (EVL) CLIA Kit
20-abx496210	Abbexa	EUR 8569.00 EUR 4560.00 EUR 1052.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

ELISA kit for Human EVL (Enah/Vasp Like Protein)
ELK6308	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Enah/Vasp Like Protein (EVL). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Enah/ Show more
Description: A sandwich ELISA kit for detection of Enah/Vasp Like Protein from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Mouse Enah/Vasp Like Protein (EVL) CLIA Kit
20-abx496551	Abbexa	EUR 8569.00 EUR 4560.00 EUR 1052.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

ELISA kit for Mouse EVL (Enah/Vasp Like Protein)
ELK8263	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Enah/Vasp Like Protein (EVL). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Enah/ Show more
Description: A sandwich ELISA kit for detection of Enah/Vasp Like Protein from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

anti-Enah/Vasp-like
YF-PA26191	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to Enah/Vasp-like

Human Ena/VASP- like protein, EVL ELISA KIT
ELI-09270h	Lifescience Market	96 Tests	EUR 824

Anti-Enah/Vasp-like (5G1)
YF-MA18517	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to Enah/Vasp-like

Anti-Enah/Vasp-like (1D6)
YF-MA18518	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to Enah/Vasp-like

Mouse Ena/VASP-Like Protein (EVL) ELISA Kit
20-abx258850	Abbexa	EUR 7504.00 EUR 3996.00 EUR 926.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse Ena/VASP- like protein, Evl ELISA KIT
ELI-09271m	Lifescience Market	96 Tests	EUR 865

Rat Ena/VASP-Like Protein (EVL) ELISA Kit
abx391304-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Ena/VASP-Like Protein (EVL) Antibody
20-abx215262	Abbexa	EUR 425.00 EUR 342.00	100 ug 50 ug
Shipped within 5-10 working days.

Ena/VASP-Like Protein (EVL) Antibody
abx431235-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

Ena/VASP-Like Protein (EVL) Antibody
abx232887-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Evl ELISA Kit| Rat Ena/VASP-like protein ELISA Kit
EF018659	Lifescience Market	96 Tests	EUR 689

Evl ELISA Kit| Mouse Ena/VASP-like protein ELISA Kit
EF014844	Lifescience Market	96 Tests	EUR 689

Human Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit
DLR-VASP-Hu-48T	DL Develop	48T	EUR 517
Should the Human Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Vasodilator Stimulated Phosphoprotein (VASP) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit
DLR-VASP-Hu-96T	DL Develop	96T	EUR 673
Should the Human Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Vasodilator Stimulated Phosphoprotein (VASP) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit
RDR-VASP-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit
RDR-VASP-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit
RD-VASP-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit
RD-VASP-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Rat Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit
DLR-VASP-Ra-48T	DL Develop	48T	EUR 549
Should the Rat Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Vasodilator Stimulated Phosphoprotein (VASP) in samples from tissue homogenates, cell lysates or other biological fluids.

Rat Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit
DLR-VASP-Ra-96T	DL Develop	96T	EUR 718
Should the Rat Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Vasodilator Stimulated Phosphoprotein (VASP) in samples from tissue homogenates, cell lysates or other biological fluids.

Rat Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit
RDR-VASP-Ra-48Tests	Reddot Biotech	48 Tests	EUR 583

Rat Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit
RDR-VASP-Ra-96Tests	Reddot Biotech	96 Tests	EUR 811

Rat Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit
RD-VASP-Ra-48Tests	Reddot Biotech	48 Tests	EUR 557

Rat Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit
RD-VASP-Ra-96Tests	Reddot Biotech	96 Tests	EUR 775

Evl/ Rat Evl ELISA Kit
ELI-30733r	Lifescience Market	96 Tests	EUR 886

EVL ELISA KIT|Human
EF009467	Lifescience Market	96 Tests	EUR 689

Human VASP ELISA Kit
ELA-E9578h	Lifescience Market	96 Tests	EUR 824

VASP ELISA KIT|Human
EF006523	Lifescience Market	96 Tests	EUR 689

EVL ELISA Kit (Human) (OKCD09468)
OKCD09468	Aviva Systems Biology	96 Wells	EUR 909
Description: Description of target: Ena/VASP proteins are actin-associated proteins involved in a range of processes dependent on cytoskeleton remodeling and cell polarity such as axon guidance and lamellipodial and filopodial dynamics in migrating cells. EVL enhances actin nucleation and polymerization.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.057ng/mL

EVL ELISA Kit (Human) (OKDD00257)
OKDD00257	Aviva Systems Biology	96 Wells	EUR 1053
Description: Description of target: Ena/VASP proteins are actin-associated proteins involved in a range of processes dependent on cytoskeleton remodeling and cell polarity such as axon guidance and lamellipodial and filopodial dynamics in migrating cells. EVL enhances actin nucleation and polymerization.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.057 ng/mL

Human Protein enabled homolog, ENAH ELISA KIT
ELI-47054h	Lifescience Market	96 Tests	EUR 824

ENAH Recombinant Protein (Human)
RP010672	ABM	100 ug	Ask for price

EVL Recombinant Protein (Human)
RP011005	ABM	100 ug	Ask for price

EVL Recombinant Protein (Human)
RP011008	ABM	100 ug	Ask for price

VASP ELISA Kit (Human) (OKCD08196)
OKCD08196	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: Vasodilator-stimulated phosphoprotein (VASP) is a member of the Ena-VASP protein family. Ena-VASP family members contain an EHV1 N-terminal domain that binds proteins containing E/DFPPPPXD/E motifs and targets Ena-VASP proteins to focal adhesions. In the mid-region of the protein, family members have a proline-rich domain that binds SH3 and WW domain-containing proteins. Their C-terminal EVH2 domain mediates tetramerization and binds both G and F actin. VASP is associated with filamentous actin formation and likely plays a widespread role in cell adhesion and motility. VASP may also be involved in the intracellular signaling pathways that regulate integrin-extracellular matrix interactions. VASP is regulated by the cyclic nucleotide-dependent kinases PKA and PKG.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.056ng/mL

ENAH, Actin Regulator (ENAH) Antibody
20-abx215152	Abbexa	EUR 425.00 EUR 342.00	100 ug 50 ug
Shipped within 5-10 working days.

ENAH, Actin Regulator (ENAH) Antibody
abx030898-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

ENAH, Actin Regulator (ENAH) Antibody
abx030898-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

ENAH, Actin Regulator (ENAH) Antibody
20-abx328350	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

EVL ELISA Kit (Mouse) (OKCD09469)
OKCD09469	Aviva Systems Biology	96 Wells	EUR 936
Description: Description of target: ;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 0.055ng/mL

Mouse Protein enabled homolog, Enah ELISA KIT
ELI-26596m	Lifescience Market	96 Tests	EUR 865

ENAH Antibody
45263-100ul	SAB	100ul	EUR 252

ENAH Antibody
45263-50ul	SAB	50ul	EUR 187

ENAH Antibody
DF8286	Affbiotech	200ul	EUR 304
Description: ENAH Antibody detects endogenous levels of total ENAH.

ENAH Antibody
1-CSB-PA030227	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against ENAH. Recognizes ENAH from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000

ENAH siRNA
20-abx915387	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

ENAH siRNA
20-abx915388	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

ENAH Antibody
ABD8286	Lifescience Market	100 ug	EUR 438

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

VASP Recombinant Protein (Human)
RP034258	ABM	100 ug	Ask for price

VASP Recombinant Protein (Human)
RP034261	ABM	100 ug	Ask for price

EVL antibody
70R-17165	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal EVL antibody

EVL Antibody
45214-100ul	SAB	100ul	EUR 252

EVL Antibody
45214-50ul	SAB	50ul	EUR 187

EVL Antibody
DF8091	Affbiotech	200ul	EUR 304
Description: EVL Antibody detects endogenous levels of total EVL.

EVL Antibody
1-CSB-PA007869GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against EVL. Recognizes EVL from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

EVL siRNA
20-abx901794	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

EVL siRNA
20-abx915772	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

EVL siRNA
20-abx915773	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

EVL Antibody
ABD8091	Lifescience Market	100 ug	EUR 438

ENAH Recombinant Protein (Rat)
RP199598	ABM	100 ug	Ask for price

ENAH Recombinant Protein (Mouse)
RP131696	ABM	100 ug	Ask for price

ENAH Recombinant Protein (Mouse)
RP131699	ABM	100 ug	Ask for price

ENAH Recombinant Protein (Mouse)
RP131702	ABM	100 ug	Ask for price

ENAH Recombinant Protein (Mouse)
RP131705	ABM	100 ug	Ask for price

VASP ELISA Kit (Mouse) (OKCA02474)
OKCA02474	Aviva Systems Biology	96 Wells	EUR 846
Description: Description of target: Ena/VASP proteins are actin-associated proteins involved in a range of processes dependent on cytoskeleton remodeling and cell polarity such as axon guidance, lamellipodial and filopodial dynamics, platelet activation and cell migration. VASP promotes actin filament elongation. It protects the barbed end of growing actin filaments against capping and increases the rate of actin polymerization in the presence of capping protein. VASP stimulates actin filament elongation by promoting the transfer of profilin-bound actin monomers onto the barbed end of growing actin filaments. Plays a role in actin-based mobility of Listeria monocytogenes in host cells. Regulates actin dynamics in platelets and plays an important role in regulating platelet aggregation.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: 1.56 pg/mL

VASP ELISA Kit (Rat) (OKDD00880)
OKDD00880	Aviva Systems Biology	96 Wells	EUR 1040
Description: Description of target: ;Species reactivity: Rat;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: <0.052ng/mL

VASP ELISA Kit (Dog) (OKEH08783)
OKEH08783	Aviva Systems Biology	96 Wells	EUR 1184
Description: Description of target: ;Species reactivity: Dog;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity:

VASP ELISA Kit (Rat) (OKEI00887)
OKEI00887	Aviva Systems Biology	96 Wells	EUR 767
Description: Description of target: Ena/VASP proteins are actin-associated proteins involved in a range of processes dependent on cytoskeleton remodeling and cell polarity such as axon guidance, lamellipodial and filopodial dynamics, platelet activation and cell migration.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.094 ng/mL

VASP ELISA Kit (Bovine) (OKEH03950)
OKEH03950	Aviva Systems Biology	96 Wells	EUR 779
Description: Description of target: Ena/VASP proteins are actin-associated proteins involved in a range of processes dependent on cytoskeleton remodeling and cell polarity such as axon guidance, lamellipodial and filopodial dynamics, platelet activation and cell migration. VASP promotes actin filament elongation. It protects the barbed end of growing actin filaments against capping and increases the rate of actin polymerization in the presence of capping protein. VASP stimulates actin filament elongation by promoting the transfer of profilin-bound actin monomers onto the barbed end of growing actin filaments. Plays a role in actin-based mobility of Listeria monocytogenes in host cells. Regulates actin dynamics in platelets and plays an important role in regulating platelet aggregation (By similarity);Species reactivity: Bovine;Application: ;Assay info: Assay Methodology: Quantitative Competitive ELISA;Sensitivity: 0.091 ng/mL

Human ENAH shRNA Plasmid
20-abx960877	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

EVL Recombinant Protein (Rat)
RP200054	ABM	100 ug	Ask for price

EVL Recombinant Protein (Mouse)
RP132431	ABM	100 ug	Ask for price

EVL Recombinant Protein (Mouse)
RP132434	ABM	100 ug	Ask for price

EVL Recombinant Protein (Mouse)
RP132437	ABM	100 ug	Ask for price

EVL Recombinant Protein (Mouse)
RP132440	ABM	100 ug	Ask for price

Human EVL shRNA Plasmid
20-abx959779	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human Vasodilator-stimulated phosphoprotein(VASP) ELISA kit
CSB-EL025797HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Vasodilator-stimulated phosphoprotein (VASP) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Vasodilator-stimulated phosphoprotein(VASP) ELISA kit
1-CSB-EL025797HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Vasodilator-stimulated phosphoprotein(VASP) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit
20-abx153458	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit
abx251857-96tests	Abbexa	96 tests	EUR 754
Shipped within 5-12 working days.

Human VASP(Vasodilator-stimulated phosphoprotein) ELISA Kit
EH2489	FN Test	96T	EUR 567.6
Detection range: 0.156-10 ng/ml Uniprot ID: P50552 Alias: VASP
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human VASP/ Vasodilator-stimulated phosphoprotein ELISA Kit
E2652Hu	Sunlong	1 Kit	EUR 605

Human Vasodilator- stimulated phosphoprotein, VASP ELISA KIT
ELI-07732h	Lifescience Market	96 Tests	EUR 824

Human Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit
abx570947-96tests	Abbexa	96 tests	EUR 754
Shipped within 5-12 working days.

Human Vasodilator Stimulated Phosphoprotein(VASP)ELISA Kit
QY-E00688	Qayee Biotechnology	96T	EUR 361

Human Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit
SEC603Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Vasodilator Stimulated Phosphoprotein (VASP) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inte Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Vasodilator Stimulated Phosphoprotein (VASP) in tissue homogenates, cell lysates and other biological fluids.

Human Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit
SEC603Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Vasodilator Stimulated Phosphoprotein (VASP) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inte Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Vasodilator Stimulated Phosphoprotein (VASP) in tissue homogenates, cell lysates and other biological fluids.

Human Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit
SEC603Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Vasodilator Stimulated Phosphoprotein (VASP) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inte Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Vasodilator Stimulated Phosphoprotein (VASP) in tissue homogenates, cell lysates and other biological fluids.

Human Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit
SEC603Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Vasodilator Stimulated Phosphoprotein (VASP) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inte Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Vasodilator Stimulated Phosphoprotein (VASP) in tissue homogenates, cell lysates and other biological fluids.

Human Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit
4-SEC603Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Vasodilator Stimulated Phosphoprotein elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Vasodilator Stimulated Phosphoprotein (VASP) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

VASP ELISA Kit (Human) : 96 Wells (OKEH01980)
OKEH01980	Aviva Systems Biology	96 Wells	EUR 779
Description: Description of target: Vasodilator-stimulated phosphoprotein (VASP) is a member of the Ena-VASP protein family. Ena-VASP family members contain an EHV1 N-terminal domain that binds proteins containing E/DFPPPPXD/E motifs and targets Ena-VASP proteins to focal adhesions. In the mid-region of the protein, family members have a proline-rich domain that binds SH3 and WW domain-containing proteins. Their C-terminal EVH2 domain mediates tetramerization and binds both G and F actin. VASP is associated with filamentous actin formation and likely plays a widespread role in cell adhesion and motility. VASP may also be involved in the intracellular signaling pathways that regulate integrin-extracellular matrix interactions. VASP is regulated by the cyclic nucleotide-dependent kinases PKA and PKG.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.056 ng/mL

ENAH Blocking Peptide
DF8286-BP	Affbiotech	1mg	EUR 195

ENAH Conjugated Antibody
C45263	SAB	100ul	EUR 397

ENAH cloning plasmid
CSB-CL854072HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 441 Sequence: atggaaattcaaagaagacaactacaagaacagcaacggcaaaaggagctggagcgggaaaggctggagcgagaaagaatggaaagagaaaggttggagagagagaggttagaaagggaaaggctggagagggagcgactggaacaagaacagctggagagagagagacaagaacg Show more
Description: A cloning plasmid for the ENAH gene.

ENAH Rabbit pAb
A17932-100ul	Abclonal	100 ul	EUR 308

ENAH Rabbit pAb
A17932-200ul	Abclonal	200 ul	EUR 459

ENAH Rabbit pAb
A17932-20ul	Abclonal	20 ul	EUR 183

ENAH Rabbit pAb
A17932-50ul	Abclonal	50 ul	EUR 223

Anti-ENAH antibody
STJ119918	St John's Laboratory	100 µl	EUR 277

Anti-ENAH (3E6)
YF-MA18819	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to ENAH

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT	SBI	1 kit (10 rxn)	EUR 1110
Category: Cas9

VASP Colorimetric Cell-Based ELISA Kit
EKC1588	BosterBio	100ul	EUR 572

Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit
abx595616-96tests	Abbexa	96 tests	EUR 637
Shipped within 1-2 weeks.

EVL Blocking Peptide
DF8091-BP	Affbiotech	1mg	EUR 195

EVL Conjugated Antibody
C45214	SAB	100ul	EUR 397

EVL cloning plasmid
CSB-CL887052HU1-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1257 Sequence: atggccacaagtgaacagagtatctgccaagcccgggcttccgtgatggtctacgatgacaccagtaagaaatgggtaccaatcaaacctggccagcagggattcagccggatcaacatctaccacaacactgccagcaacaccttcagagtcgttggagtcaagttgcaggatc Show more
Description: A cloning plasmid for the EVL gene.

EVL cloning plasmid
CSB-CL887052HU2-10ug	Cusabio	10ug	EUR 460
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1251 Sequence: atgagtgaacagagtatctgccaagcccgggcttccgtgatggtctacgatgacaccagtaagaaatgggtaccaatcaaacctggccagcagggattcagccggatcaacatctaccacaacactgccagcaacaccttcagagtcgttggagtcaagttgcaggatcagcagg Show more
Description: A cloning plasmid for the EVL gene.

anti- EVL antibody
FNab02887	FN Test	100µg	EUR 548.75
Immunogen: Enah/Vasp-like Uniprot ID: Q9UI08 Gene ID: 51466 Research Area: Signal Transduction, Developmental biology
Description: Antibody raised against EVL

Anti-EVL antibody
PAab02887	Lifescience Market	100 ug	EUR 386

Anti-EVL antibody
STJ71813	St John's Laboratory	100 µg	EUR 359

ENAH ORF Vector (Human) (pORF)
ORF003558	ABM	1.0 ug DNA	EUR 95

ENAH Protein Vector (Human) (pPB-C-His)
PV014229	ABM	500 ng	EUR 329

ENAH Protein Vector (Human) (pPB-N-His)
PV014230	ABM	500 ng	EUR 329

ENAH Protein Vector (Human) (pPM-C-HA)
PV014231	ABM	500 ng	EUR 329

ENAH Protein Vector (Human) (pPM-C-His)
PV014232	ABM	500 ng	EUR 329

ELISA kit for Human VASP (Vasodilator Stimulated Phosphoprotein)
E-EL-H2529	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's VASP ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human VASP. Standards or samples are added to the micro ELISA plate wells and combined with th Show more
Description: A sandwich ELISA kit for quantitative measurement of Human VASP (Vasodilator Stimulated Phosphoprotein) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human VASP (Vasodilator Stimulated Phosphoprotein)
ELK3481	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Vasodilator Stimulated Phosphoprotein (VASP). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody s Show more
Description: A sandwich ELISA kit for detection of Vasodilator Stimulated Phosphoprotein from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Vasodilator-stimulated phosphoprotein (VASP)
KTE60071-48T	Abbkine	48T	EUR 332
Synaptic vesicles are responsible for regulating the storage and release of neurotransmitters in the nerve terminal. Northern blot analysis revealed that a 5.8-kb transcript is expressed in electromotor neurons. Western blot analysis determined expre Show more
Description: Quantitative sandwich ELISA for measuring Human Vasodilator-stimulated phosphoprotein (VASP) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Vasodilator-stimulated phosphoprotein (VASP)
KTE60071-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Synaptic vesicles are responsible for regulating the storage and release of neurotransmitters in the nerve terminal. Northern blot analysis revealed that a 5.8-kb transcript is expressed in electromotor neurons. Western blot analysis determined expre Show more
Description: Quantitative sandwich ELISA for measuring Human Vasodilator-stimulated phosphoprotein (VASP) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Vasodilator-stimulated phosphoprotein (VASP)
KTE60071-96T	Abbkine	96T	EUR 539
Synaptic vesicles are responsible for regulating the storage and release of neurotransmitters in the nerve terminal. Northern blot analysis revealed that a 5.8-kb transcript is expressed in electromotor neurons. Western blot analysis determined expre Show more
Description: Quantitative sandwich ELISA for measuring Human Vasodilator-stimulated phosphoprotein (VASP) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

EVL ORF Vector (Human) (pORF)
ORF003669	ABM	1.0 ug DNA	EUR 95

EVL ORF Vector (Human) (pORF)
ORF003670	ABM	1.0 ug DNA	EUR 95

VASP antibody
20R-1715	Fitzgerald	100 ug	EUR 716
Description: Rabbit polyclonal VASP antibody

VASP antibody
20R-2008	Fitzgerald	50 ug	EUR 281
Description: Rabbit polyclonal VASP antibody

VASP antibody
20R-2056	Fitzgerald	50 ug	EUR 281
Description: Rabbit polyclonal VASP antibody

VASP antibody
20R-2339	Fitzgerald	50 ug	EUR 281
Description: Rabbit polyclonal VASP antibody

VASP antibody
20R-2370	Fitzgerald	50 ug	EUR 281
Description: Rabbit polyclonal VASP antibody

VASP antibody
70R-10267	Fitzgerald	50 ug	EUR 467
Description: Affinity purified rabbit polyclonal VASP antibody

VASP antibody
70R-10268	Fitzgerald	50 ug	EUR 467
Description: Affinity purified rabbit polyclonal VASP antibody

VASP antibody
70R-12030	Fitzgerald	100 ug	EUR 403
Description: Rabbit polyclonal VASP antibody

VASP antibody
70R-21241	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal VASP antibody

VASP antibody
70R-31071	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal VASP antibody

VASP Antibody
3718-100	Biovision		EUR 316

VASP Antibody
3718-30T	Biovision		EUR 146

VASP antibody
10R-6259	Fitzgerald	100 ul	EUR 726
Description: Mouse monoclonal VASP antibody

VASP antibody
10R-6261	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal VASP antibody

VASP antibody
10R-6262	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal VASP antibody

VASP antibody
10R-7236	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal VASP antibody

VASP Antibody
48793-100ul	SAB	100ul	EUR 333

VASP Antibody
48793-50ul	SAB	50ul	EUR 239

VASP Antibody
1-CSB-PA004422	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against VASP. Recognizes VASP from Human, Mouse, Rat, Monkey. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/20000

VASP Antibody
1-CSB-PA004424	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against VASP. Recognizes VASP from Human, Mouse, Rat, Monkey. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/20000

VASP Antibody
1-CSB-PA060049	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against VASP. Recognizes VASP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/5000

VASP Antibody
1-CSB-PA025797GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against VASP. Recognizes VASP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

VASP antibody
70R-34661	Fitzgerald	100 ug	EUR 327
Description: Purified Rabbit polyclonal VASP antibody

VASP antibody
70R-50533	Fitzgerald	100 ul	EUR 244
Description: Purified Polyclonal VASP antibody

VASP antibody
70R-50534	Fitzgerald	100 ul	EUR 244
Description: Purified Polyclonal VASP antibody

VASP antibody
70R-51671	Fitzgerald	100 ul	EUR 287
Description: Purified Polyclonal VASP antibody

VASP Antibody
AF6337	Affbiotech	200ul	EUR 304
Description: VASP Antibody detects endogenous levels of total VASP.

VASP Antibody
AF6338	Affbiotech	200ul	EUR 304
Description: VASP Antibody detects endogenous levels of total VASP.

VASP Antibody
1-CSB-PA010556	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against VASP. Recognizes VASP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/5000

VASP siRNA
20-abx939342	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

VASP siRNA
20-abx939343	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

VASP Antibody
ABF6337	Lifescience Market	100 ug	EUR 438

VASP Antibody
ABF6338	Lifescience Market	100 ug	EUR 438

anti-VASP
YF-PA15255	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to VASP

anti-VASP
YF-PA15256	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to VASP

EVL Protein Vector (Human) (pPB-C-His)
PV014673	ABM	500 ng	EUR 329

EVL Protein Vector (Human) (pPB-N-His)
PV014674	ABM	500 ng	EUR 329

EVL Protein Vector (Human) (pPM-C-HA)
PV014675	ABM	500 ng	EUR 329

EVL Protein Vector (Human) (pPM-C-His)
PV014676	ABM	500 ng	EUR 329

EVL Protein Vector (Human) (pPB-C-His)
PV014677	ABM	500 ng	EUR 329

EVL Protein Vector (Human) (pPB-N-His)
PV014678	ABM	500 ng	EUR 329

EVL Protein Vector (Human) (pPM-C-HA)
PV014679	ABM	500 ng	EUR 329

EVL Protein Vector (Human) (pPM-C-His)
PV014680	ABM	500 ng	EUR 329

VASP protein (His tag)
80R-1761	Fitzgerald	50 ug	EUR 397
Description: Purified recombinant Human VASP protein

VASP Recombinant Protein (Rat)
RP236285	ABM	100 ug	Ask for price

VASP Recombinant Protein (Mouse)
RP183659	ABM	100 ug	Ask for price

Human VASP shRNA Plasmid
20-abx955067	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human Vasodilator Stimulated Phosphoprotein (VASP) Protein
20-abx655467	Abbexa	EUR 690.00 EUR 286.00 EUR 2124.00 EUR 815.00 EUR 495.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Mouse ENAH shRNA Plasmid
20-abx970170	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Column Packing Kit
PACK-KIT	Next Advance	1pack	EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

Bovine VASP/ Vasodilator-stimulated phosphoprotein ELISA Kit
E0281Bo	Sunlong	1 Kit	EUR 717

Rat Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit
20-abx156215	Abbexa	EUR 7237.00 EUR 3855.00 EUR 895.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Canine Vasodilator-stimulated phosphoprotein, VASP ELISA KIT
ELI-07731d	Lifescience Market	96 Tests	EUR 928

Mouse Vasodilator- stimulated phosphoprotein, Vasp ELISA KIT
ELI-07733m	Lifescience Market	96 Tests	EUR 865

Bovine Vasodilator- stimulated phosphoprotein, VASP ELISA KIT
ELI-07734b	Lifescience Market	96 Tests	EUR 928

Cow Vasodilator-stimulated phosphoprotein (VASP) ELISA Kit
abx521216-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Dog Vasodilator-stimulated phosphoprotein (VASP) ELISA Kit
abx521217-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Mouse Vasodilator-stimulated phosphoprotein (VASP) ELISA Kit
abx521219-96tests	Abbexa	96 tests	EUR 739
Shipped within 5-12 working days.

Rat Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit
abx571896-96tests	Abbexa	96 tests	EUR 786
Shipped within 5-12 working days.

Rat Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit
SEC603Ra-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5124.2
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Vasodilator Stimulated Phosphoprotein (VASP) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter- Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Vasodilator Stimulated Phosphoprotein (VASP) in tissue homogenates, cell lysates and other biological fluids.

Rat Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit
SEC603Ra-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 509.64
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Vasodilator Stimulated Phosphoprotein (VASP) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter- Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Vasodilator Stimulated Phosphoprotein (VASP) in tissue homogenates, cell lysates and other biological fluids.

Rat Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit
SEC603Ra-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 685.2
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Vasodilator Stimulated Phosphoprotein (VASP) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter- Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Vasodilator Stimulated Phosphoprotein (VASP) in tissue homogenates, cell lysates and other biological fluids.

Rat Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit
SEC603Ra-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2783.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Vasodilator Stimulated Phosphoprotein (VASP) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter- Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Vasodilator Stimulated Phosphoprotein (VASP) in tissue homogenates, cell lysates and other biological fluids.

Rat Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit
4-SEC603Ra	Cloud-Clone	EUR 5175.00 EUR 2734.00 EUR 686.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Vasodilator Stimulated Phosphoprotein elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Vasodilator Stimulated Phosphoprotein (VASP) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human EVL(Enah/Vasp Like Protein) ELISA Kit