Orbital Biosciences online

Ultrafiltration and Microfiltration Solutions for the Biosciences

Human EVL(Enah/Vasp Like Protein) ELISA Kit

Human EVL(Enah/Vasp Like Protein) ELISA Kit

Human Enah/Vasp Like Protein (EVL) ELISA Kit

RD-EVL-Hu-48Tests 48 Tests
EUR 563

Human Enah/Vasp Like Protein (EVL) ELISA Kit

RD-EVL-Hu-96Tests 96 Tests
EUR 783

Human Enah/Vasp Like Protein (EVL) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Enah/Vasp Like Protein(EVL)ELISA Kit

QY-E04947 96T
EUR 361

Human Enah/Vasp Like Protein (EVL) ELISA Kit

SEQ820Hu-10x96wellstestplate 10x96-wells test plate
EUR 5189.65
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Enah/Vasp Like Protein (EVL) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Enah/Vasp Like Protein (EVL) in tissue homogenates, cell lysates and other biological fluids.

Human Enah/Vasp Like Protein (EVL) ELISA Kit

SEQ820Hu-1x48wellstestplate 1x48-wells test plate
EUR 515.03
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Enah/Vasp Like Protein (EVL) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Enah/Vasp Like Protein (EVL) in tissue homogenates, cell lysates and other biological fluids.

Human Enah/Vasp Like Protein (EVL) ELISA Kit

SEQ820Hu-1x96wellstestplate 1x96-wells test plate
EUR 692.9
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Enah/Vasp Like Protein (EVL) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Enah/Vasp Like Protein (EVL) in tissue homogenates, cell lysates and other biological fluids.

Human Enah/Vasp Like Protein (EVL) ELISA Kit

SEQ820Hu-5x96wellstestplate 5x96-wells test plate
EUR 2818.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Enah/Vasp Like Protein (EVL) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Enah/Vasp Like Protein (EVL) in tissue homogenates, cell lysates and other biological fluids.

Human Enah/Vasp Like Protein (EVL) ELISA Kit

  • EUR 5240.00
  • EUR 2769.00
  • EUR 693.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Enah/Vasp Like Protein elisa. Alternative names of the recognized antigen: RNB6
  • Enabled/Vasodilator Stimulated Phosphoprotein Like protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Enah/Vasp Like Protein (EVL) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Enah/Vasp Like Protein (EVL) Antibody

  • EUR 1316.00
  • EUR 620.00
  • 1 mg
  • 200 ug
  • Please enquire.

Enah/Vasp Like Protein (EVL) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Enah/Vasp Like Protein (EVL) Antibody

  • EUR 926.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Human Enah/Vasp Like Protein (EVL) Protein

  • EUR 648.00
  • EUR 272.00
  • EUR 1998.00
  • EUR 773.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Mouse Enah/Vasp Like Protein ELISA Kit (EVL)

RK02774 96 Tests
EUR 521

Mouse Enah/Vasp Like Protein (EVL) ELISA Kit

SEQ820Mu-10x96wellstestplate 10x96-wells test plate
EUR 5333.64
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Enah/Vasp Like Protein (EVL) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Enah/Vasp Like Protein (EVL) in tissue homogenates, cell lysates and other biological fluids.

Mouse Enah/Vasp Like Protein (EVL) ELISA Kit

SEQ820Mu-1x48wellstestplate 1x48-wells test plate
EUR 526.89
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Enah/Vasp Like Protein (EVL) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Enah/Vasp Like Protein (EVL) in tissue homogenates, cell lysates and other biological fluids.

Mouse Enah/Vasp Like Protein (EVL) ELISA Kit

SEQ820Mu-1x96wellstestplate 1x96-wells test plate
EUR 709.84
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Enah/Vasp Like Protein (EVL) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Enah/Vasp Like Protein (EVL) in tissue homogenates, cell lysates and other biological fluids.

Mouse Enah/Vasp Like Protein (EVL) ELISA Kit

SEQ820Mu-5x96wellstestplate 5x96-wells test plate
EUR 2894.28
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Enah/Vasp Like Protein (EVL) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Enah/Vasp Like Protein (EVL) in tissue homogenates, cell lysates and other biological fluids.

Mouse Enah/Vasp Like Protein (EVL) ELISA Kit

  • EUR 5384.00
  • EUR 2845.00
  • EUR 710.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Enah/Vasp Like Protein elisa. Alternative names of the recognized antigen: RNB6
  • Enabled/Vasodilator Stimulated Phosphoprotein Like protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Enah/Vasp Like Protein (EVL) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Enah/Vasp Like Protein (EVL) CLIA Kit

  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ELISA kit for Human EVL (Enah/Vasp Like Protein)

ELK6308 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Enah/Vasp Like Protein (EVL). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Enah/
  • Show more
Description: A sandwich ELISA kit for detection of Enah/Vasp Like Protein from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Mouse Enah/Vasp Like Protein (EVL) CLIA Kit

  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ELISA kit for Mouse EVL (Enah/Vasp Like Protein)

ELK8263 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Enah/Vasp Like Protein (EVL). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Enah/
  • Show more
Description: A sandwich ELISA kit for detection of Enah/Vasp Like Protein from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.


YF-PA26191 50 ul
EUR 334
Description: Mouse polyclonal to Enah/Vasp-like

Human Ena/VASP- like protein, EVL ELISA KIT

ELI-09270h 96 Tests
EUR 824

Anti-Enah/Vasp-like (5G1)

YF-MA18517 100 ug
EUR 363
Description: Mouse monoclonal to Enah/Vasp-like

Anti-Enah/Vasp-like (1D6)

YF-MA18518 100 ug
EUR 363
Description: Mouse monoclonal to Enah/Vasp-like

Mouse Ena/VASP-Like Protein (EVL) ELISA Kit

  • EUR 7504.00
  • EUR 3996.00
  • EUR 926.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Ena/VASP- like protein, Evl ELISA KIT

ELI-09271m 96 Tests
EUR 865

Rat Ena/VASP-Like Protein (EVL) ELISA Kit

abx391304-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Ena/VASP-Like Protein (EVL) Antibody

  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ena/VASP-Like Protein (EVL) Antibody

abx431235-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Ena/VASP-Like Protein (EVL) Antibody

abx232887-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Evl ELISA Kit| Rat Ena/VASP-like protein ELISA Kit

EF018659 96 Tests
EUR 689

Evl ELISA Kit| Mouse Ena/VASP-like protein ELISA Kit

EF014844 96 Tests
EUR 689

Human Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit

EUR 517
  • Should the Human Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Vasodilator Stimulated Phosphoprotein (VASP) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit

EUR 673
  • Should the Human Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Vasodilator Stimulated Phosphoprotein (VASP) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit

RDR-VASP-Hu-48Tests 48 Tests
EUR 544

Human Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit

RDR-VASP-Hu-96Tests 96 Tests
EUR 756

Human Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit

RD-VASP-Hu-48Tests 48 Tests
EUR 521

Human Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit

RD-VASP-Hu-96Tests 96 Tests
EUR 723

Rat Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit

EUR 549
  • Should the Rat Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Vasodilator Stimulated Phosphoprotein (VASP) in samples from tissue homogenates, cell lysates or other biological fluids.

Rat Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit

EUR 718
  • Should the Rat Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Vasodilator Stimulated Phosphoprotein (VASP) in samples from tissue homogenates, cell lysates or other biological fluids.

Rat Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit

RDR-VASP-Ra-48Tests 48 Tests
EUR 583

Rat Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit

RDR-VASP-Ra-96Tests 96 Tests
EUR 811

Rat Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit

RD-VASP-Ra-48Tests 48 Tests
EUR 557

Rat Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit

RD-VASP-Ra-96Tests 96 Tests
EUR 775

Evl/ Rat Evl ELISA Kit

ELI-30733r 96 Tests
EUR 886


EF009467 96 Tests
EUR 689


ELA-E9578h 96 Tests
EUR 824


EF006523 96 Tests
EUR 689

EVL ELISA Kit (Human) (OKCD09468)

OKCD09468 96 Wells
EUR 909
Description: Description of target: Ena/VASP proteins are actin-associated proteins involved in a range of processes dependent on cytoskeleton remodeling and cell polarity such as axon guidance and lamellipodial and filopodial dynamics in migrating cells. EVL enhances actin nucleation and polymerization.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.057ng/mL

EVL ELISA Kit (Human) (OKDD00257)

OKDD00257 96 Wells
EUR 1053
Description: Description of target: Ena/VASP proteins are actin-associated proteins involved in a range of processes dependent on cytoskeleton remodeling and cell polarity such as axon guidance and lamellipodial and filopodial dynamics in migrating cells. EVL enhances actin nucleation and polymerization.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.057 ng/mL

Human Protein enabled homolog, ENAH ELISA KIT

ELI-47054h 96 Tests
EUR 824

ENAH Recombinant Protein (Human)

RP010672 100 ug Ask for price

EVL Recombinant Protein (Human)

RP011005 100 ug Ask for price

EVL Recombinant Protein (Human)

RP011008 100 ug Ask for price

VASP ELISA Kit (Human) (OKCD08196)

OKCD08196 96 Wells
EUR 975
Description: Description of target: Vasodilator-stimulated phosphoprotein (VASP) is a member of the Ena-VASP protein family. Ena-VASP family members contain an EHV1 N-terminal domain that binds proteins containing E/DFPPPPXD/E motifs and targets Ena-VASP proteins to focal adhesions. In the mid-region of the protein, family members have a proline-rich domain that binds SH3 and WW domain-containing proteins. Their C-terminal EVH2 domain mediates tetramerization and binds both G and F actin. VASP is associated with filamentous actin formation and likely plays a widespread role in cell adhesion and motility. VASP may also be involved in the intracellular signaling pathways that regulate integrin-extracellular matrix interactions. VASP is regulated by the cyclic nucleotide-dependent kinases PKA and PKG.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.056ng/mL

ENAH, Actin Regulator (ENAH) Antibody

  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

ENAH, Actin Regulator (ENAH) Antibody

abx030898-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

ENAH, Actin Regulator (ENAH) Antibody

abx030898-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

ENAH, Actin Regulator (ENAH) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

EVL ELISA Kit (Mouse) (OKCD09469)

OKCD09469 96 Wells
EUR 936
Description: Description of target: ;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 0.055ng/mL

Mouse Protein enabled homolog, Enah ELISA KIT

ELI-26596m 96 Tests
EUR 865

ENAH Antibody

45263-100ul 100ul
EUR 252

ENAH Antibody

45263-50ul 50ul
EUR 187

ENAH Antibody

DF8286 200ul
EUR 304
Description: ENAH Antibody detects endogenous levels of total ENAH.

ENAH Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against ENAH. Recognizes ENAH from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ENAH Antibody

ABD8286 100 ug
EUR 438

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202

VASP Recombinant Protein (Human)

RP034258 100 ug Ask for price

VASP Recombinant Protein (Human)

RP034261 100 ug Ask for price

EVL antibody

70R-17165 50 ul
EUR 435
Description: Rabbit polyclonal EVL antibody

EVL Antibody

45214-100ul 100ul
EUR 252

EVL Antibody

45214-50ul 50ul
EUR 187

EVL Antibody

DF8091 200ul
EUR 304
Description: EVL Antibody detects endogenous levels of total EVL.

EVL Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against EVL. Recognizes EVL from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

EVL Antibody

ABD8091 100 ug
EUR 438

ENAH Recombinant Protein (Rat)

RP199598 100 ug Ask for price

ENAH Recombinant Protein (Mouse)

RP131696 100 ug Ask for price

ENAH Recombinant Protein (Mouse)

RP131699 100 ug Ask for price

ENAH Recombinant Protein (Mouse)

RP131702 100 ug Ask for price

ENAH Recombinant Protein (Mouse)

RP131705 100 ug Ask for price

VASP ELISA Kit (Mouse) (OKCA02474)

OKCA02474 96 Wells
EUR 846
Description: Description of target: Ena/VASP proteins are actin-associated proteins involved in a range of processes dependent on cytoskeleton remodeling and cell polarity such as axon guidance, lamellipodial and filopodial dynamics, platelet activation and cell migration. VASP promotes actin filament elongation. It protects the barbed end of growing actin filaments against capping and increases the rate of actin polymerization in the presence of capping protein. VASP stimulates actin filament elongation by promoting the transfer of profilin-bound actin monomers onto the barbed end of growing actin filaments. Plays a role in actin-based mobility of Listeria monocytogenes in host cells. Regulates actin dynamics in platelets and plays an important role in regulating platelet aggregation.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: 1.56 pg/mL

VASP ELISA Kit (Rat) (OKDD00880)

OKDD00880 96 Wells
EUR 1040
Description: Description of target: ;Species reactivity: Rat;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: <0.052ng/mL

VASP ELISA Kit (Dog) (OKEH08783)

OKEH08783 96 Wells
EUR 1184
Description: Description of target: ;Species reactivity: Dog;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity:

VASP ELISA Kit (Rat) (OKEI00887)

OKEI00887 96 Wells
EUR 767
Description: Description of target: Ena/VASP proteins are actin-associated proteins involved in a range of processes dependent on cytoskeleton remodeling and cell polarity such as axon guidance, lamellipodial and filopodial dynamics, platelet activation and cell migration.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.094 ng/mL

VASP ELISA Kit (Bovine) (OKEH03950)

OKEH03950 96 Wells
EUR 779
Description: Description of target: Ena/VASP proteins are actin-associated proteins involved in a range of processes dependent on cytoskeleton remodeling and cell polarity such as axon guidance, lamellipodial and filopodial dynamics, platelet activation and cell migration. VASP promotes actin filament elongation. It protects the barbed end of growing actin filaments against capping and increases the rate of actin polymerization in the presence of capping protein. VASP stimulates actin filament elongation by promoting the transfer of profilin-bound actin monomers onto the barbed end of growing actin filaments. Plays a role in actin-based mobility of Listeria monocytogenes in host cells. Regulates actin dynamics in platelets and plays an important role in regulating platelet aggregation (By similarity);Species reactivity: Bovine;Application: ;Assay info: Assay Methodology: Quantitative Competitive ELISA;Sensitivity: 0.091 ng/mL

Human ENAH shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

EVL Recombinant Protein (Rat)

RP200054 100 ug Ask for price

EVL Recombinant Protein (Mouse)

RP132431 100 ug Ask for price

EVL Recombinant Protein (Mouse)

RP132434 100 ug Ask for price

EVL Recombinant Protein (Mouse)

RP132437 100 ug Ask for price

EVL Recombinant Protein (Mouse)

RP132440 100 ug Ask for price

Human EVL shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human Vasodilator-stimulated phosphoprotein(VASP) ELISA kit

CSB-EL025797HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Vasodilator-stimulated phosphoprotein (VASP) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Vasodilator-stimulated phosphoprotein(VASP) ELISA kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Vasodilator-stimulated phosphoprotein(VASP) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit

abx251857-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

Human VASP(Vasodilator-stimulated phosphoprotein) ELISA Kit

EH2489 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: P50552
  • Alias: VASP
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human VASP/ Vasodilator-stimulated phosphoprotein ELISA Kit

E2652Hu 1 Kit
EUR 605

Human Vasodilator- stimulated phosphoprotein, VASP ELISA KIT

ELI-07732h 96 Tests
EUR 824

Human Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit

abx570947-96tests 96 tests
EUR 754
  • Shipped within 5-12 working days.

Human Vasodilator Stimulated Phosphoprotein(VASP)ELISA Kit

QY-E00688 96T
EUR 361

Human Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit

SEC603Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Vasodilator Stimulated Phosphoprotein (VASP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inte
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Vasodilator Stimulated Phosphoprotein (VASP) in tissue homogenates, cell lysates and other biological fluids.

Human Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit

SEC603Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Vasodilator Stimulated Phosphoprotein (VASP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inte
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Vasodilator Stimulated Phosphoprotein (VASP) in tissue homogenates, cell lysates and other biological fluids.

Human Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit

SEC603Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Vasodilator Stimulated Phosphoprotein (VASP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inte
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Vasodilator Stimulated Phosphoprotein (VASP) in tissue homogenates, cell lysates and other biological fluids.

Human Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit

SEC603Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Vasodilator Stimulated Phosphoprotein (VASP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inte
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Vasodilator Stimulated Phosphoprotein (VASP) in tissue homogenates, cell lysates and other biological fluids.

Human Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Vasodilator Stimulated Phosphoprotein elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Vasodilator Stimulated Phosphoprotein (VASP) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

VASP ELISA Kit (Human) : 96 Wells (OKEH01980)

OKEH01980 96 Wells
EUR 779
Description: Description of target: Vasodilator-stimulated phosphoprotein (VASP) is a member of the Ena-VASP protein family. Ena-VASP family members contain an EHV1 N-terminal domain that binds proteins containing E/DFPPPPXD/E motifs and targets Ena-VASP proteins to focal adhesions. In the mid-region of the protein, family members have a proline-rich domain that binds SH3 and WW domain-containing proteins. Their C-terminal EVH2 domain mediates tetramerization and binds both G and F actin. VASP is associated with filamentous actin formation and likely plays a widespread role in cell adhesion and motility. VASP may also be involved in the intracellular signaling pathways that regulate integrin-extracellular matrix interactions. VASP is regulated by the cyclic nucleotide-dependent kinases PKA and PKG.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.056 ng/mL

ENAH Blocking Peptide

DF8286-BP 1mg
EUR 195

ENAH Conjugated Antibody

C45263 100ul
EUR 397

ENAH cloning plasmid

CSB-CL854072HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 441
  • Sequence: atggaaattcaaagaagacaactacaagaacagcaacggcaaaaggagctggagcgggaaaggctggagcgagaaagaatggaaagagaaaggttggagagagagaggttagaaagggaaaggctggagagggagcgactggaacaagaacagctggagagagagagacaagaacg
  • Show more
Description: A cloning plasmid for the ENAH gene.

ENAH Rabbit pAb

A17932-100ul 100 ul
EUR 308

ENAH Rabbit pAb

A17932-200ul 200 ul
EUR 459

ENAH Rabbit pAb

A17932-20ul 20 ul
EUR 183

ENAH Rabbit pAb

A17932-50ul 50 ul
EUR 223

Anti-ENAH antibody

STJ119918 100 µl
EUR 277

Anti-ENAH (3E6)

YF-MA18819 100 ug
EUR 363
Description: Mouse monoclonal to ENAH

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

VASP Colorimetric Cell-Based ELISA Kit

EKC1588 100ul
EUR 572

Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit

abx595616-96tests 96 tests
EUR 637
  • Shipped within 1-2 weeks.

EVL Blocking Peptide

DF8091-BP 1mg
EUR 195

EVL Conjugated Antibody

C45214 100ul
EUR 397

EVL cloning plasmid

CSB-CL887052HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1257
  • Sequence: atggccacaagtgaacagagtatctgccaagcccgggcttccgtgatggtctacgatgacaccagtaagaaatgggtaccaatcaaacctggccagcagggattcagccggatcaacatctaccacaacactgccagcaacaccttcagagtcgttggagtcaagttgcaggatc
  • Show more
Description: A cloning plasmid for the EVL gene.

EVL cloning plasmid

CSB-CL887052HU2-10ug 10ug
EUR 460
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1251
  • Sequence: atgagtgaacagagtatctgccaagcccgggcttccgtgatggtctacgatgacaccagtaagaaatgggtaccaatcaaacctggccagcagggattcagccggatcaacatctaccacaacactgccagcaacaccttcagagtcgttggagtcaagttgcaggatcagcagg
  • Show more
Description: A cloning plasmid for the EVL gene.

anti- EVL antibody

FNab02887 100µg
EUR 548.75
  • Immunogen: Enah/Vasp-like
  • Uniprot ID: Q9UI08
  • Gene ID: 51466
  • Research Area: Signal Transduction, Developmental biology
Description: Antibody raised against EVL

Anti-EVL antibody

PAab02887 100 ug
EUR 386

Anti-EVL antibody

STJ71813 100 µg
EUR 359

ENAH ORF Vector (Human) (pORF)

ORF003558 1.0 ug DNA
EUR 95

ENAH Protein Vector (Human) (pPB-C-His)

PV014229 500 ng
EUR 329

ENAH Protein Vector (Human) (pPB-N-His)

PV014230 500 ng
EUR 329

ENAH Protein Vector (Human) (pPM-C-HA)

PV014231 500 ng
EUR 329

ENAH Protein Vector (Human) (pPM-C-His)

PV014232 500 ng
EUR 329

ELISA kit for Human VASP (Vasodilator Stimulated Phosphoprotein)

E-EL-H2529 1 plate of 96 wells
EUR 534
  • Gentaur's VASP ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human VASP. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human VASP (Vasodilator Stimulated Phosphoprotein) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human VASP (Vasodilator Stimulated Phosphoprotein)

ELK3481 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Vasodilator Stimulated Phosphoprotein (VASP). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody s
  • Show more
Description: A sandwich ELISA kit for detection of Vasodilator Stimulated Phosphoprotein from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Vasodilator-stimulated phosphoprotein (VASP)

KTE60071-48T 48T
EUR 332
  • Synaptic vesicles are responsible for regulating the storage and release of neurotransmitters in the nerve terminal. Northern blot analysis revealed that a 5.8-kb transcript is expressed in electromotor neurons. Western blot analysis determined expre
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Vasodilator-stimulated phosphoprotein (VASP) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Vasodilator-stimulated phosphoprotein (VASP)

KTE60071-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Synaptic vesicles are responsible for regulating the storage and release of neurotransmitters in the nerve terminal. Northern blot analysis revealed that a 5.8-kb transcript is expressed in electromotor neurons. Western blot analysis determined expre
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Vasodilator-stimulated phosphoprotein (VASP) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Vasodilator-stimulated phosphoprotein (VASP)

KTE60071-96T 96T
EUR 539
  • Synaptic vesicles are responsible for regulating the storage and release of neurotransmitters in the nerve terminal. Northern blot analysis revealed that a 5.8-kb transcript is expressed in electromotor neurons. Western blot analysis determined expre
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Vasodilator-stimulated phosphoprotein (VASP) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

EVL ORF Vector (Human) (pORF)

ORF003669 1.0 ug DNA
EUR 95

EVL ORF Vector (Human) (pORF)

ORF003670 1.0 ug DNA
EUR 95

VASP antibody

20R-1715 100 ug
EUR 716
Description: Rabbit polyclonal VASP antibody

VASP antibody

20R-2008 50 ug
EUR 281
Description: Rabbit polyclonal VASP antibody

VASP antibody

20R-2056 50 ug
EUR 281
Description: Rabbit polyclonal VASP antibody

VASP antibody

20R-2339 50 ug
EUR 281
Description: Rabbit polyclonal VASP antibody

VASP antibody

20R-2370 50 ug
EUR 281
Description: Rabbit polyclonal VASP antibody

VASP antibody

70R-10267 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal VASP antibody

VASP antibody

70R-10268 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal VASP antibody

VASP antibody

70R-12030 100 ug
EUR 403
Description: Rabbit polyclonal VASP antibody

VASP antibody

70R-21241 50 ul
EUR 435
Description: Rabbit polyclonal VASP antibody

VASP antibody

70R-31071 100 ug
EUR 327
Description: Rabbit polyclonal VASP antibody

VASP Antibody

EUR 316

VASP Antibody

EUR 146

VASP antibody

10R-6259 100 ul
EUR 726
Description: Mouse monoclonal VASP antibody

VASP antibody

10R-6261 100 ul
EUR 691
Description: Mouse monoclonal VASP antibody

VASP antibody

10R-6262 100 ul
EUR 691
Description: Mouse monoclonal VASP antibody

VASP antibody

10R-7236 100 ul
EUR 691
Description: Mouse monoclonal VASP antibody

VASP Antibody

48793-100ul 100ul
EUR 333

VASP Antibody

48793-50ul 50ul
EUR 239

VASP Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against VASP. Recognizes VASP from Human, Mouse, Rat, Monkey. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/20000

VASP Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against VASP. Recognizes VASP from Human, Mouse, Rat, Monkey. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/20000

VASP Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against VASP. Recognizes VASP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/5000

VASP Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against VASP. Recognizes VASP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

VASP antibody

70R-34661 100 ug
EUR 327
Description: Purified Rabbit polyclonal VASP antibody

VASP antibody

70R-50533 100 ul
EUR 244
Description: Purified Polyclonal VASP antibody

VASP antibody

70R-50534 100 ul
EUR 244
Description: Purified Polyclonal VASP antibody

VASP antibody

70R-51671 100 ul
EUR 287
Description: Purified Polyclonal VASP antibody

VASP Antibody

AF6337 200ul
EUR 304
Description: VASP Antibody detects endogenous levels of total VASP.

VASP Antibody

AF6338 200ul
EUR 304
Description: VASP Antibody detects endogenous levels of total VASP.

VASP Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against VASP. Recognizes VASP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/5000


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

VASP Antibody

ABF6337 100 ug
EUR 438

VASP Antibody

ABF6338 100 ug
EUR 438


YF-PA15255 50 ug
EUR 363
Description: Mouse polyclonal to VASP


YF-PA15256 100 ug
EUR 403
Description: Rabbit polyclonal to VASP

EVL Protein Vector (Human) (pPB-C-His)

PV014673 500 ng
EUR 329

EVL Protein Vector (Human) (pPB-N-His)

PV014674 500 ng
EUR 329

EVL Protein Vector (Human) (pPM-C-HA)

PV014675 500 ng
EUR 329

EVL Protein Vector (Human) (pPM-C-His)

PV014676 500 ng
EUR 329

EVL Protein Vector (Human) (pPB-C-His)

PV014677 500 ng
EUR 329

EVL Protein Vector (Human) (pPB-N-His)

PV014678 500 ng
EUR 329

EVL Protein Vector (Human) (pPM-C-HA)

PV014679 500 ng
EUR 329

EVL Protein Vector (Human) (pPM-C-His)

PV014680 500 ng
EUR 329

VASP protein (His tag)

80R-1761 50 ug
EUR 397
Description: Purified recombinant Human VASP protein

VASP Recombinant Protein (Rat)

RP236285 100 ug Ask for price

VASP Recombinant Protein (Mouse)

RP183659 100 ug Ask for price

Human VASP shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human Vasodilator Stimulated Phosphoprotein (VASP) Protein

  • EUR 690.00
  • EUR 286.00
  • EUR 2124.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Mouse ENAH shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

Bovine VASP/ Vasodilator-stimulated phosphoprotein ELISA Kit

E0281Bo 1 Kit
EUR 717

Rat Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit

  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Canine Vasodilator-stimulated phosphoprotein, VASP ELISA KIT

ELI-07731d 96 Tests
EUR 928

Mouse Vasodilator- stimulated phosphoprotein, Vasp ELISA KIT

ELI-07733m 96 Tests
EUR 865

Bovine Vasodilator- stimulated phosphoprotein, VASP ELISA KIT

ELI-07734b 96 Tests
EUR 928

Cow Vasodilator-stimulated phosphoprotein (VASP) ELISA Kit

abx521216-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Dog Vasodilator-stimulated phosphoprotein (VASP) ELISA Kit

abx521217-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Vasodilator-stimulated phosphoprotein (VASP) ELISA Kit

abx521219-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Rat Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit

abx571896-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.

Rat Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit

SEC603Ra-10x96wellstestplate 10x96-wells test plate
EUR 5124.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Vasodilator Stimulated Phosphoprotein (VASP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Vasodilator Stimulated Phosphoprotein (VASP) in tissue homogenates, cell lysates and other biological fluids.

Rat Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit

SEC603Ra-1x48wellstestplate 1x48-wells test plate
EUR 509.64
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Vasodilator Stimulated Phosphoprotein (VASP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Vasodilator Stimulated Phosphoprotein (VASP) in tissue homogenates, cell lysates and other biological fluids.

Rat Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit

SEC603Ra-1x96wellstestplate 1x96-wells test plate
EUR 685.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Vasodilator Stimulated Phosphoprotein (VASP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Vasodilator Stimulated Phosphoprotein (VASP) in tissue homogenates, cell lysates and other biological fluids.

Rat Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit

SEC603Ra-5x96wellstestplate 5x96-wells test plate
EUR 2783.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Vasodilator Stimulated Phosphoprotein (VASP) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Vasodilator Stimulated Phosphoprotein (VASP) in tissue homogenates, cell lysates and other biological fluids.

Rat Vasodilator Stimulated Phosphoprotein (VASP) ELISA Kit

  • EUR 5175.00
  • EUR 2734.00
  • EUR 686.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Vasodilator Stimulated Phosphoprotein elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Vasodilator Stimulated Phosphoprotein (VASP) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human EVL(Enah/Vasp Like Protein) ELISA Kit