Mouse CAST(Calpastatin) ELISA Kit

Mouse CAST(Calpastatin) ELISA Kit

Mouse Calpastatin (CAST) ELISA Kit

RD-CAST-Mu-96Tests 96 Tests
EUR 740

Mouse Calpastatin (CAST) ELISA Kit

RDR-CAST-Mu-48Tests 48 Tests
EUR 557

Mouse Calpastatin (CAST) ELISA Kit

RDR-CAST-Mu-96Tests 96 Tests
EUR 774

Mouse Calpastatin (CAST) ELISA Kit

abx570739-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Mouse Calpastatin, Cast ELISA KIT

ELI-03958m 96 Tests
EUR 865

Mouse CAST(Calpastatin) ELISA Kit

EM0903 96T
EUR 524.1
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: P51125
  • Alias: CAST/Calpain inhibitor
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 0.094 ng/ml

Mouse Calpastatin (CAST) ELISA Kit

20-abx153759
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Calpastatin (CAST) ELISA Kit

abx255243-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Mouse Calpastatin (CAST) ELISA Kit

SEC416Mu-10x96wellstestplate 10x96-wells test plate
EUR 4862.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Calpastatin (CAST) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Calpastatin (CAST) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Calpastatin (CAST) ELISA Kit

SEC416Mu-1x48wellstestplate 1x48-wells test plate
EUR 488.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Calpastatin (CAST) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Calpastatin (CAST) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Calpastatin (CAST) ELISA Kit

SEC416Mu-1x96wellstestplate 1x96-wells test plate
EUR 654.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Calpastatin (CAST) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Calpastatin (CAST) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Calpastatin (CAST) ELISA Kit

SEC416Mu-5x96wellstestplate 5x96-wells test plate
EUR 2644.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Calpastatin (CAST) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Calpastatin (CAST) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Calpastatin (CAST) ELISA Kit

4-SEC416Mu
  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Calpastatin elisa. Alternative names of the recognized antigen: BS17
  • Calpain inhibitor
  • Sperm BS-17 component
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Calpastatin (CAST) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

ELISA kit for Mouse CAST (Calpastatin)

E-EL-M0223 1 plate of 96 wells
EUR 534
  • Gentaur's CAST ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse CAST. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Mouse CAST (Calpastatin) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Mouse CAST (Calpastatin)

ELK6093 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Calpastatin (CAST). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Calpastatin (CA
  • Show more
Description: A sandwich ELISA kit for detection of Calpastatin from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Mouse Calpastatin (CAST)

KTE71503-48T 48T
EUR 332
  • Calpastatin is an endogenous calpain (calcium-dependent cysteine protease) inhibitor. It consists of an N-terminal domain L and four repetitive calpain-inhibition domains (domains 1-7), and it is involved in the proteolysis of amyloid precursor prote
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Calpastatin (CAST) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Calpastatin (CAST)

KTE71503-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Calpastatin is an endogenous calpain (calcium-dependent cysteine protease) inhibitor. It consists of an N-terminal domain L and four repetitive calpain-inhibition domains (domains 1-7), and it is involved in the proteolysis of amyloid precursor prote
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Calpastatin (CAST) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Calpastatin (CAST)

KTE71503-96T 96T
EUR 539
  • Calpastatin is an endogenous calpain (calcium-dependent cysteine protease) inhibitor. It consists of an N-terminal domain L and four repetitive calpain-inhibition domains (domains 1-7), and it is involved in the proteolysis of amyloid precursor prote
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Calpastatin (CAST) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Mouse Calpastatin (CAST) CLIA Kit

20-abx493673
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Mouse Calpastatin (CAST) CLIA Kit

abx196770-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Mouse Calpastatin (CAST) Protein

20-abx652753
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Mouse Calpastatin (CAST) Protein

20-abx652754
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

CAST ELISA Kit| Mouse Calpastatin ELISA Kit

EF013494 96 Tests
EUR 689

Sheep Calpastatin (CAST) ELISA Kit

abx364193-96tests 96 tests
EUR 926
  • Shipped within 5-12 working days.

Cow Calpastatin (CAST) ELISA Kit

abx515726-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Calpastatin (CAST) ELISA Kit

abx515727-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Pig Calpastatin (CAST) ELISA Kit

abx515729-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Rat Calpastatin (CAST) ELISA Kit

abx515730-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Rabbit Calpastatin, CAST ELISA KIT

ELI-03953Ra 96 Tests
EUR 928

Porcine Calpastatin, CAST ELISA KIT

ELI-03955p 96 Tests
EUR 928

Bovine Calpastatin, CAST ELISA KIT

ELI-03956b 96 Tests
EUR 928

Human Calpastatin, CAST ELISA KIT

ELI-03957h 96 Tests
EUR 824

Pig CAST/ Calpastatin ELISA Kit

E0030Pi 1 Kit
EUR 717

Rat Cast/ Calpastatin ELISA Kit

E0161Ra 1 Kit
EUR 571

for Calpastatin (CAST)ELISA kit

SEC416Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Calpastatin (CAST) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Calpastatin (CAST) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

for Calpastatin (CAST)ELISA kit

SEC416Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Calpastatin (CAST) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Calpastatin (CAST) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

for Calpastatin (CAST)ELISA kit

SEC416Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Calpastatin (CAST) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Calpastatin (CAST) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

for Calpastatin (CAST)ELISA kit

SEC416Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Calpastatin (CAST) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Calpastatin (CAST) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

ELISA Kit for Calpastatin (CAST)

4-SEC416Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Calpastatin elisa. Alternative names of the recognized antigen: BS17
  • Calpain inhibitor
  • Sperm BS-17 component
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Calpastatin (CAST) in samples from Serum, plasma, tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Calpastatin(CAST)ELISA Kit

QY-E03508 96T
EUR 361

Calpastatin (CAST) Antibody

20-abx111334
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Calpastatin (CAST) Antibody

20-abx109594
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Calpastatin (CAST) Antibody

20-abx000552
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Calpastatin (CAST) Antibody

20-abx007229
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Calpastatin (CAST) Antibody

20-abx175679
  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Calpastatin (CAST) Antibody

20-abx175680
  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Calpastatin (CAST) Antibody

20-abx211100
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Calpastatin (CAST) Antibody

20-abx211215
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Calpastatin (CAST) Antibody

abx231220-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Human Calpastatin (CAST)

1-CSB-YP004561HU
  • EUR 430.00
  • EUR 234.00
  • EUR 1508.00
  • EUR 642.00
  • EUR 1009.00
  • EUR 291.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 73.9 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Calpastatin(CAST) expressed in Yeast

Human Calpastatin (CAST)

1-CSB-EP004561HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 75.9 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Calpastatin(CAST) expressed in E.coli

CLIA kit for Mouse CAST (Calpastatin)

E-CL-M0160 1 plate of 96 wells
EUR 584
  • Gentaur's CAST CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Mouse CAST . Standards or samples are added to the micro CLIA plate wells and combined with the
  • Show more
Description: A sandwich CLIA kit for quantitative measurement of Mouse CAST (Calpastatin) in samples from Serum, Plasma, Cell supernatant

Calpastatin (CAST) Antibody (Biotin)

20-abx105207
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Calpastatin (CAST) Antibody (FITC)

20-abx106624
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Calpastatin (CAST) Antibody (HRP)

20-abx108041
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-Calpastatin/CAST Antibody

A00337 100ug/vial
EUR 334

Human calpastatin/calpain inhibitor(CAST)ELISA kit

CSB-E17483h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human calpastatin/calpain inhibitor (CAST) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human calpastatin/calpain inhibitor(CAST)ELISA kit

1-CSB-E17483h
  • EUR 900.00
  • EUR 5476.00
  • EUR 2900.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human calpastatin/calpain inhibitor(CAST) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Cast/ Rat Cast ELISA Kit

ELI-03954r 96 Tests
EUR 886

Calpastatin ELISA KIT|Human

EF008356 96 Tests
EUR 689

Mouse calpastatin/calpain inhibitor ELISA kit

E03C1397-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse calpastatin/calpain inhibitor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse calpastatin/calpain inhibitor ELISA kit

E03C1397-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse calpastatin/calpain inhibitor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse calpastatin/calpain inhibitor ELISA kit

E03C1397-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse calpastatin/calpain inhibitor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Calpastatin

RP-1530 2 ug
EUR 347

Human CAST ELISA Kit

ELA-E1198h 96 Tests
EUR 824

ELISA kit for Pig Calpastatin

EK2933 96 tests
EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Pig Calpastatin in samples from serum, plasma, tissue homogenates and other biological fluids.

Calpastatin antibody

10R-C111a 100 ul
EUR 619
Description: Mouse monoclonal Calpastatin antibody

Calpastatin antibody

10R-C111b 100 ul
EUR 673
Description: Mouse monoclonal Calpastatin antibody

anti-Calpastatin

YF-PA10670 50 ul
EUR 363
Description: Mouse polyclonal to Calpastatin

anti-Calpastatin

YF-PA10671 50 ug
EUR 363
Description: Mouse polyclonal to Calpastatin

anti-Calpastatin

YF-PA10672 50 ul
EUR 363
Description: Mouse polyclonal to Calpastatin

anti-Calpastatin

YF-PA10673 100 ug
EUR 403
Description: Rabbit polyclonal to Calpastatin

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

Goat calpastatin/calpain inhibitor ELISA kit

E06C1397-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat calpastatin/calpain inhibitor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat calpastatin/calpain inhibitor ELISA kit

E06C1397-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat calpastatin/calpain inhibitor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat calpastatin/calpain inhibitor ELISA kit

E06C1397-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat calpastatin/calpain inhibitor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat calpastatin/calpain inhibitor ELISA kit

E02C1397-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat calpastatin/calpain inhibitor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat calpastatin/calpain inhibitor ELISA kit

E02C1397-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat calpastatin/calpain inhibitor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat calpastatin/calpain inhibitor ELISA kit

E02C1397-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat calpastatin/calpain inhibitor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit calpastatin/calpain inhibitor ELISA kit

E04C1397-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit calpastatin/calpain inhibitor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit calpastatin/calpain inhibitor ELISA kit

E04C1397-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit calpastatin/calpain inhibitor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit calpastatin/calpain inhibitor ELISA kit

E04C1397-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit calpastatin/calpain inhibitor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human calpastatin/calpain inhibitor ELISA kit

E01C1397-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human calpastatin/calpain inhibitor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human calpastatin/calpain inhibitor ELISA kit

E01C1397-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human calpastatin/calpain inhibitor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human calpastatin/calpain inhibitor ELISA kit

E01C1397-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human calpastatin/calpain inhibitor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig calpastatin/calpain inhibitor ELISA kit

E07C1397-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine calpastatin/calpain inhibitor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig calpastatin/calpain inhibitor ELISA kit

E07C1397-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine calpastatin/calpain inhibitor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig calpastatin/calpain inhibitor ELISA kit

E07C1397-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine calpastatin/calpain inhibitor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog calpastatin/calpain inhibitor ELISA kit

E08C1397-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine calpastatin/calpain inhibitor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog calpastatin/calpain inhibitor ELISA kit

E08C1397-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine calpastatin/calpain inhibitor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog calpastatin/calpain inhibitor ELISA kit

E08C1397-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine calpastatin/calpain inhibitor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey calpastatin/calpain inhibitor ELISA kit

E09C1397-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey calpastatin/calpain inhibitor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey calpastatin/calpain inhibitor ELISA kit

E09C1397-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey calpastatin/calpain inhibitor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey calpastatin/calpain inhibitor ELISA kit

E09C1397-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey calpastatin/calpain inhibitor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse CAST shRNA Plasmid

20-abx969491
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CAST Recombinant Protein (Mouse)

RP121307 100 ug Ask for price

CAST siRNA

20-abx900806
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CAST siRNA

20-abx910360
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CAST siRNA

20-abx910361
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CAST Antibody

36300-100ul 100ul
EUR 252

CAST antibody

70R-16186 50 ul
EUR 435
Description: Rabbit polyclonal CAST antibody

CAST Antibody

1-CSB-PA004561GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against CAST. Recognizes CAST from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

CAST Antibody

1-CSB-PA004561YA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CAST. Recognizes CAST from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:1000-1:5000, IHC:1:10-1:500, IF:1:50-1:200

CAST Antibody

1-CSB-PA597777
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CAST. Recognizes CAST from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:100-1:300

CAST Antibody

1-CSB-PA260515
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CAST. Recognizes CAST from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

anti-CAST

YF-PA27184 50 ug
EUR 363
Description: Mouse polyclonal to CAST

Guinea pig calpastatin/calpain inhibitor ELISA kit

E05C1397-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig calpastatin/calpain inhibitor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig calpastatin/calpain inhibitor ELISA kit

E05C1397-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig calpastatin/calpain inhibitor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig calpastatin/calpain inhibitor ELISA kit

E05C1397-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig calpastatin/calpain inhibitor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

anti- Calpastatin antibody

FNab01220 100µg
EUR 505.25
  • Immunogen: calpastatin
  • Uniprot ID: P20810
  • Research Area: Neuroscience, Metabolism
Description: Antibody raised against Calpastatin

Calpastatin Polyclonal Antibody

42103-100ul 100ul
EUR 333

Anti-Calpastatin antibody

PAab01220 100 ug
EUR 355

Anti-Calpastatin (2C5)

YF-MA12259 100 ug
EUR 363
Description: Mouse monoclonal to Calpastatin

Cast ORF Vector (Mouse) (pORF)

ORF040437 1.0 ug DNA
EUR 506

Erc1 ELISA Kit| Mouse ELKS/Rab6-interacting/CAST family member

EF014770 96 Tests
EUR 689

CAST Conjugated Antibody

C34652 100ul
EUR 397

CAST Conjugated Antibody

C36300 100ul
EUR 397

CAST cloning plasmid

CSB-CL004561HU-10ug 10ug
EUR 671
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2004
  • Sequence: atgaatcccacagaaaccaaggctgtaaaaacagaacctgagaagaagtcacagtcaaccaagccaaaaagcctacccaagcaggcatcagatacaggaagtaacgatgctcacaataaaaaagcagtttccagatcagctgaacagcagccatcagagaaatcaacagaaccaa
  • Show more
Description: A cloning plasmid for the CAST gene.

CAST Rabbit pAb

A0097-100ul 100 ul
EUR 308

CAST Rabbit pAb

A0097-200ul 200 ul
EUR 459

CAST Rabbit pAb

A0097-20ul 20 ul
EUR 183

CAST Rabbit pAb

A0097-50ul 50 ul
EUR 223

CAST Polyclonal Antibody

A54656 100 µg
EUR 570.55
Description: The best epigenetics products

CAST Rabbit pAb

A13683-100ul 100 ul
EUR 308

CAST Rabbit pAb

A13683-200ul 200 ul
EUR 459

CAST Rabbit pAb

A13683-20ul 20 ul
EUR 183

CAST Rabbit pAb

A13683-50ul 50 ul
EUR 223

CAST Rabbit pAb

A16789-100ul 100 ul
EUR 308

CAST Rabbit pAb

A16789-200ul 200 ul
EUR 459

CAST Rabbit pAb

A16789-20ul 20 ul
EUR 183

CAST Rabbit pAb

A16789-50ul 50 ul
EUR 223

CAST Rabbit pAb

A16790-100ul 100 ul
EUR 308

CAST Rabbit pAb

A16790-200ul 200 ul
EUR 459

CAST Rabbit pAb

A16790-20ul 20 ul
EUR 183

CAST Rabbit pAb

A16790-50ul 50 ul
EUR 223

pCMV-SPORT6-CAST

PVT13136 2 ug
EUR 391

Anti-CAST antibody

STJ29949 100 µl
EUR 413
Description: The protein encoded by this gene is an endogenous calpain (calcium-dependent cysteine protease) inhibitor. It consists of an N-terminal domain L and four repetitive calpain-inhibition domains (domains 1-4), and it is involved in the proteolysis of amyloid precursor protein. The calpain/calpastatin system is involved in numerous membrane fusion events, such as neural vesicle exocytosis and platelet and red-cell aggregation. The encoded protein is also thought to affect the expression levels of genes encoding structural or regulatory proteins. Alternatively spliced transcript variants encoding different isoforms have been described.

Anti-CAST antibody

STJ22910 100 µl
EUR 277
Description: The protein encoded by this gene is an endogenous calpain (calcium-dependent cysteine protease) inhibitor. It consists of an N-terminal domain L and four repetitive calpain-inhibition domains (domains 1-4), and it is involved in the proteolysis of amyloid precursor protein. The calpain/calpastatin system is involved in numerous membrane fusion events, such as neural vesicle exocytosis and platelet and red-cell aggregation. The encoded protein is also thought to affect the expression levels of genes encoding structural or regulatory proteins. Alternatively spliced transcript variants encoding different isoforms have been described.

Anti-CAST antibody

STJ119189 100 µl
EUR 277

Anti-CAST antibody

STJ119190 100 µl
EUR 277

Anti-CAST antibody

STJ115638 100 µl
EUR 277
Description: The protein encoded by this gene is an endogenous calpain (calcium-dependent cysteine protease) inhibitor. It consists of an N-terminal domain L and four repetitive calpain-inhibition domains (domains 1-4), and it is involved in the proteolysis of amyloid precursor protein. The calpain/calpastatin system is involved in numerous membrane fusion events, such as neural vesicle exocytosis and platelet and red-cell aggregation. The encoded protein is also thought to affect the expression levels of genes encoding structural or regulatory proteins. Alternatively spliced transcript variants encoding different isoforms have been described.

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Calpastatin Polyclonal Conjugated Antibody

C42103 100ul
EUR 397

Calpastatin protein (Domain 1)

30R-AC005 1 mg
EUR 635
Description: Purified recombinant Human Calpastatin protein (Domain 1)

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

Cast sgRNA CRISPR Lentivector set (Mouse)

K3360001 3 x 1.0 ug
EUR 339

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

Mouse ELKS/Rab6-Interacting/CAST Family Member 1 (ERC1) ELISA Kit

abx389140-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

CAST Polyclonal Conjugated Antibody

C30990 100ul
EUR 397

Rat CAST shRNA Plasmid

20-abx984994
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human CAST shRNA Plasmid

20-abx950585
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CAST Antibody, HRP conjugated

1-CSB-PA004561YB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CAST. Recognizes CAST from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

CAST Antibody, FITC conjugated

1-CSB-PA004561YC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CAST. Recognizes CAST from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

CAST Antibody, Biotin conjugated

1-CSB-PA004561YD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CAST. Recognizes CAST from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

CAST Recombinant Protein (Human)

RP005683 100 ug Ask for price

CAST Recombinant Protein (Rat)

RP193238 100 ug Ask for price

CAST Recombinant Protein (Rat)

RP193241 100 ug Ask for price

CAST Recombinant Protein (Rat)

RP193244 100 ug Ask for price

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV100PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV105PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV120PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV125PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Acetyl-Calpastatin (184-210) (human)

H-4076.0500 0.5mg
EUR 181
Description: Sum Formula: C142H230N36O44S; CAS# [123714-50-1] net

Acetyl-Calpastatin (184-210) (human)

H-4076.1000 1.0mg
EUR 302
Description: Sum Formula: C142H230N36O44S; CAS# [123714-50-1] net

Acetyl-Calpastatin (184-210) (human)

A4410-1 1 mg
EUR 551
Description: Selective calpain inhibitor. Strongly inhibits calpain I (Ki = 0.2 nM) and II but does not inhibit papain, trypsin and cathepsin L (Ki = 6 ?M). Increases secretion of amyoid ?-protein (A?) 42, A?40 and A?42 ratio.

Ac-Calpastatin (184-210) (human)

5-00551 4 x 1mg Ask for price

Anti-Calpastatin Antibody (monoclonal, 14E12)

M00337 100ug/vial
EUR 334

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS700A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS720A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS740A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Cast sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3360002 1.0 ug DNA
EUR 154

Cast sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3360003 1.0 ug DNA
EUR 154

Cast sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3360004 1.0 ug DNA
EUR 154

CAST Protein Vector (Mouse) (pPB-C-His)

PV161746 500 ng
EUR 1065

CAST Protein Vector (Mouse) (pPB-N-His)

PV161747 500 ng
EUR 1065

CAST Protein Vector (Mouse) (pPM-C-HA)

PV161748 500 ng
EUR 1065

CAST Protein Vector (Mouse) (pPM-C-His)

PV161749 500 ng
EUR 1065

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV200PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV205PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV220PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV225PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

casting base

EHS3100-CAST ea
EUR 107

casting base

EHS3200-CAST ea
EUR 124

casting base

EHS3300-CAST ea
EUR 124

gelcaster for sequencer

ESEQ1000-CAST ea
EUR 437

Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS750A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS770A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS790A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]

CAS9LIG-KIT 1 Kit
EUR 153
  • Category: Cas9

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

CAST Polyclonal Antibody, Biotin Conjugated

A54653 100 µg
EUR 570.55
Description: Ask the seller for details

CAST Polyclonal Antibody, FITC Conjugated

A54654 100 µg
EUR 570.55
Description: The best epigenetics products

CAST Polyclonal Antibody, HRP Conjugated

A54655 100 µg
EUR 570.55
Description: kits suitable for this type of research

[KO Validated] CAST Rabbit pAb

A7634-100ul 100 ul
EUR 410

[KO Validated] CAST Rabbit pAb

A7634-200ul 200 ul
EUR 571

[KO Validated] CAST Rabbit pAb

A7634-20ul 20 ul
EUR 221

[KO Validated] CAST Rabbit pAb

A7634-50ul 50 ul
EUR 287

[KO Validated] CAST Polyclonal Antibody

30990-100ul 100ul
EUR 252

[KO Validated] CAST Polyclonal Antibody

30990-50ul 50ul
EUR 187

Mouse CAST(Calpastatin) ELISA Kit