Mouse CAST(Calpastatin) ELISA Kit
 ELISA Kit) Mouse Calpastatin (CAST) ELISA Kit |
|
RD-CAST-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 740 |
Mouse Calpastatin (CAST) ELISA Kit |
|
RDR-CAST-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 557 |
Mouse Calpastatin (CAST) ELISA Kit |
|
RDR-CAST-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 774 |
Mouse Calpastatin (CAST) ELISA Kit |
|
abx570739-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
 ELISA Kit) Mouse CAST(Calpastatin) ELISA Kit |
|
EM0903 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 0.156-10 ng/ml
- Uniprot ID: P51125
- Alias: CAST/Calpain inhibitor
|
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 0.094 ng/ml |
Mouse Calpastatin (CAST) ELISA Kit |
|
20-abx153759 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Mouse Calpastatin (CAST) ELISA Kit |
|
abx255243-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
Mouse Calpastatin (CAST) ELISA Kit |
|
SEC416Mu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4862.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Calpastatin (CAST) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Calpastatin (CAST) in Tissue homogenates, cell lysates and other biological fluids. |
Mouse Calpastatin (CAST) ELISA Kit |
|
SEC416Mu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 488.08 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Calpastatin (CAST) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Calpastatin (CAST) in Tissue homogenates, cell lysates and other biological fluids. |
Mouse Calpastatin (CAST) ELISA Kit |
|
SEC416Mu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 654.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Calpastatin (CAST) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Calpastatin (CAST) in Tissue homogenates, cell lysates and other biological fluids. |
Mouse Calpastatin (CAST) ELISA Kit |
|
SEC416Mu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2644.8 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Calpastatin (CAST) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Calpastatin (CAST) in Tissue homogenates, cell lysates and other biological fluids. |
Mouse Calpastatin (CAST) ELISA Kit |
|
4-SEC416Mu |
Cloud-Clone |
-
EUR 4913.00
-
EUR 2595.00
-
EUR 655.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Calpastatin elisa. Alternative names of the recognized antigen: BS17
- Calpain inhibitor
- Sperm BS-17 component
|
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Calpastatin (CAST) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
) ELISA kit for Mouse CAST (Calpastatin) |
|
E-EL-M0223 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's CAST ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse CAST. Standards or samples are added to the micro ELISA plate wells and combined with th
- Show more
|
|
Description: A sandwich ELISA kit for quantitative measurement of Mouse CAST (Calpastatin) in samples from Serum, Plasma, Cell supernatant |
ELISA kit for Mouse CAST (Calpastatin) |
|
ELK6093 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Calpastatin (CAST). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Calpastatin (CA
- Show more
|
|
Description: A sandwich ELISA kit for detection of Calpastatin from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
) ELISA kit for Mouse Calpastatin (CAST) |
|
KTE71503-48T |
Abbkine |
48T |
EUR 332 |
- Calpastatin is an endogenous calpain (calcium-dependent cysteine protease) inhibitor. It consists of an N-terminal domain L and four repetitive calpain-inhibition domains (domains 1-7), and it is involved in the proteolysis of amyloid precursor prote
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Mouse Calpastatin (CAST) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Calpastatin (CAST) |
|
KTE71503-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Calpastatin is an endogenous calpain (calcium-dependent cysteine protease) inhibitor. It consists of an N-terminal domain L and four repetitive calpain-inhibition domains (domains 1-7), and it is involved in the proteolysis of amyloid precursor prote
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Mouse Calpastatin (CAST) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Calpastatin (CAST) |
|
KTE71503-96T |
Abbkine |
96T |
EUR 539 |
- Calpastatin is an endogenous calpain (calcium-dependent cysteine protease) inhibitor. It consists of an N-terminal domain L and four repetitive calpain-inhibition domains (domains 1-7), and it is involved in the proteolysis of amyloid precursor prote
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Mouse Calpastatin (CAST) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
 CLIA Kit) Mouse Calpastatin (CAST) CLIA Kit |
|
20-abx493673 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
|
Mouse Calpastatin (CAST) CLIA Kit |
|
abx196770-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
 Protein) Mouse Calpastatin (CAST) Protein |
|
20-abx652753 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Mouse Calpastatin (CAST) Protein |
|
20-abx652754 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
 ELISA Kit) Sheep Calpastatin (CAST) ELISA Kit |
|
abx364193-96tests |
Abbexa |
96 tests |
EUR 926 |
- Shipped within 5-12 working days.
|
 ELISA Kit) Cow Calpastatin (CAST) ELISA Kit |
|
abx515726-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
 ELISA Kit) Human Calpastatin (CAST) ELISA Kit |
|
abx515727-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
 ELISA Kit) Pig Calpastatin (CAST) ELISA Kit |
|
abx515729-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
 ELISA Kit) Rat Calpastatin (CAST) ELISA Kit |
|
abx515730-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
 Pig CAST/ Calpastatin ELISA Kit |
|
E0030Pi |
Sunlong |
1 Kit |
EUR 717 |
 Rat Cast/ Calpastatin ELISA Kit |
|
E0161Ra |
Sunlong |
1 Kit |
EUR 571 |
ELISA kit) for Calpastatin (CAST)ELISA kit |
|
SEC416Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Calpastatin (CAST) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Calpastatin (CAST) in serum, plasma, tissue homogenates, cell lysates and other biological fluids. |
for Calpastatin (CAST)ELISA kit |
|
SEC416Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Calpastatin (CAST) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Calpastatin (CAST) in serum, plasma, tissue homogenates, cell lysates and other biological fluids. |
for Calpastatin (CAST)ELISA kit |
|
SEC416Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Calpastatin (CAST) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Calpastatin (CAST) in serum, plasma, tissue homogenates, cell lysates and other biological fluids. |
for Calpastatin (CAST)ELISA kit |
|
SEC416Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Calpastatin (CAST) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Calpastatin (CAST) in serum, plasma, tissue homogenates, cell lysates and other biological fluids. |
) ELISA Kit for Calpastatin (CAST) |
|
4-SEC416Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Calpastatin elisa. Alternative names of the recognized antigen: BS17
- Calpain inhibitor
- Sperm BS-17 component
|
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Calpastatin (CAST) in samples from Serum, plasma, tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species. |
 Antibody) Calpastatin (CAST) Antibody |
|
20-abx111334 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Calpastatin (CAST) Antibody |
|
20-abx109594 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Calpastatin (CAST) Antibody |
|
20-abx000552 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Calpastatin (CAST) Antibody |
|
20-abx007229 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Calpastatin (CAST) Antibody |
|
20-abx175679 |
Abbexa |
|
|
|
|
Calpastatin (CAST) Antibody |
|
20-abx175680 |
Abbexa |
|
|
|
|
Calpastatin (CAST) Antibody |
|
20-abx211100 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Calpastatin (CAST) Antibody |
|
20-abx211215 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Calpastatin (CAST) Antibody |
|
abx231220-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
) Human Calpastatin (CAST) |
|
1-CSB-YP004561HU |
Cusabio |
-
EUR 430.00
-
EUR 234.00
-
EUR 1508.00
-
EUR 642.00
-
EUR 1009.00
-
EUR 291.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 73.9 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
|
Description: Recombinant Human Calpastatin(CAST) expressed in Yeast |
Human Calpastatin (CAST) |
|
1-CSB-EP004561HU |
Cusabio |
-
EUR 380.00
-
EUR 214.00
-
EUR 1309.00
-
EUR 560.00
-
EUR 873.00
-
EUR 262.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 75.9 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
|
Description: Recombinant Human Calpastatin(CAST) expressed in E.coli |
) CLIA kit for Mouse CAST (Calpastatin) |
|
E-CL-M0160 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 584 |
- Gentaur's CAST CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Mouse CAST . Standards or samples are added to the micro CLIA plate wells and combined with the
- Show more
|
|
Description: A sandwich CLIA kit for quantitative measurement of Mouse CAST (Calpastatin) in samples from Serum, Plasma, Cell supernatant |
 Antibody (Biotin)) Calpastatin (CAST) Antibody (Biotin) |
|
20-abx105207 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Antibody (FITC)) Calpastatin (CAST) Antibody (FITC) |
|
20-abx106624 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Antibody (HRP)) Calpastatin (CAST) Antibody (HRP) |
|
20-abx108041 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Anti-Calpastatin/CAST Antibody |
|
A00337 |
BosterBio |
100ug/vial |
EUR 334 |
ELISA kit) Human calpastatin/calpain inhibitor(CAST)ELISA kit |
|
CSB-E17483h-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
|
Description: Quantitativesandwich ELISA kit for measuring Human calpastatin/calpain inhibitor (CAST) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human calpastatin/calpain inhibitor(CAST)ELISA kit |
|
1-CSB-E17483h |
Cusabio |
-
EUR 900.00
-
EUR 5476.00
-
EUR 2900.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
|
Description: Quantitativesandwich ELISA kit for measuring Human calpastatin/calpain inhibitor(CAST) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
 (OKCD02423)) CAST ELISA Kit (Mouse) (OKCD02423) |
|
OKCD02423 |
Aviva Systems Biology |
96 Wells |
EUR 857 |
|
Description: Description of target: Specific inhibition of calpain (calcium-dependent cysteine protease). Plays a key role in postmortem tenderization of meat and have been proposed to be involved in muscle protein degradation in living tissue. ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.054 ng/mL |
 (OKEH06884)) CAST ELISA Kit (Mouse) (OKEH06884) |
|
OKEH06884 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
|
Description: Description of target: Specific inhibition of calpain (calcium-dependent cysteine protease). Plays a key role in postmortem tenderization of meat and have been proposed to be involved in muscle protein degradation in living tissue. ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.082 ng/mL |
 Mouse calpastatin/calpain inhibitor ELISA kit |
|
E03C1397-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Mouse calpastatin/calpain inhibitor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse calpastatin/calpain inhibitor ELISA kit |
|
E03C1397-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Mouse calpastatin/calpain inhibitor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse calpastatin/calpain inhibitor ELISA kit |
|
E03C1397-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Mouse calpastatin/calpain inhibitor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 ELISA kit for Pig Calpastatin |
|
EK2933 |
SAB |
96 tests |
EUR 670 |
|
Description: Enzyme-linked immunosorbent assay kit for quantification of Pig Calpastatin in samples from serum, plasma, tissue homogenates and other biological fluids. |
 (OKEH03907)) CAST ELISA Kit (Pig) (OKEH03907) |
|
OKEH03907 |
Aviva Systems Biology |
96 Wells |
EUR 779 |
|
Description: Description of target: Specific inhibition of calpain (calcium-dependent cysteine protease). Plays a key role in postmortem tenderization of meat and have been proposed to be involved in muscle protein degradation in living tissue.;Species reactivity: Pig;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 28 pg/mL |
 (OKEH06206)) CAST ELISA Kit (Rat) (OKEH06206) |
|
OKEH06206 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
|
Description: Description of target: Specific inhibition of calpain (calcium-dependent cysteine protease). Plays a key role in postmortem tenderization of meat and have been proposed to be involved in muscle protein degradation in living tissue. ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.083 ng/mL |
 (OKEH07794)) CAST ELISA Kit (Human) (OKEH07794) |
|
OKEH07794 |
Aviva Systems Biology |
96 Wells |
EUR 896 |
|
Description: Description of target: The protein encoded by this gene is an endogenous calpain (calcium-dependent cysteine protease) inhibitor. It consists of an N-terminal domain L and four repetitive calpain-inhibition domains (domains 1-4), and it is involved in the proteolysis of amyloid precursor protein. The calpain/calpastatin system is involved in numerous membrane fusion events, such as neural vesicle exocytosis and platelet and red-cell aggregation. The encoded protein is also thought to affect the expression levels of genes encoding structural or regulatory proteins. Alternatively spliced transcript variants encoding different isoforms have been described.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.089ng/mL |
 Calpastatin antibody |
|
10R-C111a |
Fitzgerald |
100 ul |
EUR 619 |
|
Description: Mouse monoclonal Calpastatin antibody |
Calpastatin antibody |
|
10R-C111b |
Fitzgerald |
100 ul |
EUR 673 |
|
Description: Mouse monoclonal Calpastatin antibody |
 anti-Calpastatin |
|
YF-PA10670 |
Abfrontier |
50 ul |
EUR 363 |
|
Description: Mouse polyclonal to Calpastatin |
anti-Calpastatin |
|
YF-PA10671 |
Abfrontier |
50 ug |
EUR 363 |
|
Description: Mouse polyclonal to Calpastatin |
anti-Calpastatin |
|
YF-PA10672 |
Abfrontier |
50 ul |
EUR 363 |
|
Description: Mouse polyclonal to Calpastatin |
anti-Calpastatin |
|
YF-PA10673 |
Abfrontier |
100 ug |
EUR 403 |
|
Description: Rabbit polyclonal to Calpastatin |
 Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
|
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
 Goat calpastatin/calpain inhibitor ELISA kit |
|
E06C1397-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Goat calpastatin/calpain inhibitor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat calpastatin/calpain inhibitor ELISA kit |
|
E06C1397-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Goat calpastatin/calpain inhibitor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat calpastatin/calpain inhibitor ELISA kit |
|
E06C1397-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Goat calpastatin/calpain inhibitor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 Rat calpastatin/calpain inhibitor ELISA kit |
|
E02C1397-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Rat calpastatin/calpain inhibitor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat calpastatin/calpain inhibitor ELISA kit |
|
E02C1397-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Rat calpastatin/calpain inhibitor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat calpastatin/calpain inhibitor ELISA kit |
|
E02C1397-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Rat calpastatin/calpain inhibitor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 Rabbit calpastatin/calpain inhibitor ELISA kit |
|
E04C1397-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Rabbit calpastatin/calpain inhibitor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit calpastatin/calpain inhibitor ELISA kit |
|
E04C1397-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Rabbit calpastatin/calpain inhibitor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit calpastatin/calpain inhibitor ELISA kit |
|
E04C1397-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Rabbit calpastatin/calpain inhibitor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 Human calpastatin/calpain inhibitor ELISA kit |
|
E01C1397-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Human calpastatin/calpain inhibitor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human calpastatin/calpain inhibitor ELISA kit |
|
E01C1397-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Human calpastatin/calpain inhibitor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human calpastatin/calpain inhibitor ELISA kit |
|
E01C1397-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Human calpastatin/calpain inhibitor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 Pig calpastatin/calpain inhibitor ELISA kit |
|
E07C1397-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Porcine calpastatin/calpain inhibitor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig calpastatin/calpain inhibitor ELISA kit |
|
E07C1397-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Porcine calpastatin/calpain inhibitor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig calpastatin/calpain inhibitor ELISA kit |
|
E07C1397-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Porcine calpastatin/calpain inhibitor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 Dog calpastatin/calpain inhibitor ELISA kit |
|
E08C1397-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Canine calpastatin/calpain inhibitor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog calpastatin/calpain inhibitor ELISA kit |
|
E08C1397-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Canine calpastatin/calpain inhibitor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog calpastatin/calpain inhibitor ELISA kit |
|
E08C1397-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Canine calpastatin/calpain inhibitor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 Monkey calpastatin/calpain inhibitor ELISA kit |
|
E09C1397-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Monkey calpastatin/calpain inhibitor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey calpastatin/calpain inhibitor ELISA kit |
|
E09C1397-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Monkey calpastatin/calpain inhibitor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey calpastatin/calpain inhibitor ELISA kit |
|
E09C1397-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Monkey calpastatin/calpain inhibitor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 Mouse CAST shRNA Plasmid |
|
20-abx969491 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) CAST Recombinant Protein (Mouse) |
|
RP121307 |
ABM |
100 ug |
Ask for price |
 CAST siRNA |
|
20-abx900806 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CAST siRNA |
|
20-abx910360 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
CAST siRNA |
|
20-abx910361 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 CAST Antibody |
|
36300-100ul |
SAB |
100ul |
EUR 252 |
 CAST antibody |
|
70R-16186 |
Fitzgerald |
50 ul |
EUR 435 |
|
Description: Rabbit polyclonal CAST antibody |
CAST Antibody |
|
1-CSB-PA004561GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
|
Description: A polyclonal antibody against CAST. Recognizes CAST from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
CAST Antibody |
|
1-CSB-PA004561YA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against CAST. Recognizes CAST from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:1000-1:5000, IHC:1:10-1:500, IF:1:50-1:200 |
CAST Antibody |
|
1-CSB-PA597777 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
|
Description: A polyclonal antibody against CAST. Recognizes CAST from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:100-1:300 |
CAST Antibody |
|
1-CSB-PA260515 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
|
Description: A polyclonal antibody against CAST. Recognizes CAST from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200 |
 anti-CAST |
|
YF-PA27184 |
Abfrontier |
50 ug |
EUR 363 |
|
Description: Mouse polyclonal to CAST |
 Guinea pig calpastatin/calpain inhibitor ELISA kit |
|
E05C1397-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Guinea pig calpastatin/calpain inhibitor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig calpastatin/calpain inhibitor ELISA kit |
|
E05C1397-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Guinea pig calpastatin/calpain inhibitor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig calpastatin/calpain inhibitor ELISA kit |
|
E05C1397-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Guinea pig calpastatin/calpain inhibitor in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 anti- Calpastatin antibody |
|
FNab01220 |
FN Test |
100µg |
EUR 505.25 |
- Immunogen: calpastatin
- Uniprot ID: P20810
- Research Area: Neuroscience, Metabolism
|
|
Description: Antibody raised against Calpastatin |
 Calpastatin Polyclonal Antibody |
|
42103-100ul |
SAB |
100ul |
EUR 333 |
) Anti-Calpastatin (2C5) |
|
YF-MA12259 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to Calpastatin |
 (pORF)) Cast ORF Vector (Mouse) (pORF) |
|
ORF040437 |
ABM |
1.0 ug DNA |
EUR 506 |
 CAST Conjugated Antibody |
|
C34652 |
SAB |
100ul |
EUR 397 |
CAST Conjugated Antibody |
|
C36300 |
SAB |
100ul |
EUR 397 |
 CAST cloning plasmid |
|
CSB-CL004561HU-10ug |
Cusabio |
10ug |
EUR 671 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2004
- Sequence: atgaatcccacagaaaccaaggctgtaaaaacagaacctgagaagaagtcacagtcaaccaagccaaaaagcctacccaagcaggcatcagatacaggaagtaacgatgctcacaataaaaaagcagtttccagatcagctgaacagcagccatcagagaaatcaacagaaccaa
- Show more
|
|
Description: A cloning plasmid for the CAST gene. |
 CAST Rabbit pAb |
|
A0097-100ul |
Abclonal |
100 ul |
EUR 308 |
CAST Rabbit pAb |
|
A0097-200ul |
Abclonal |
200 ul |
EUR 459 |
CAST Rabbit pAb |
|
A0097-20ul |
Abclonal |
20 ul |
EUR 183 |
CAST Rabbit pAb |
|
A0097-50ul |
Abclonal |
50 ul |
EUR 223 |
 CAST Polyclonal Antibody |
|
A54656 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: The best epigenetics products |
CAST Rabbit pAb |
|
A13683-100ul |
Abclonal |
100 ul |
EUR 308 |
CAST Rabbit pAb |
|
A13683-200ul |
Abclonal |
200 ul |
EUR 459 |
CAST Rabbit pAb |
|
A13683-20ul |
Abclonal |
20 ul |
EUR 183 |
CAST Rabbit pAb |
|
A13683-50ul |
Abclonal |
50 ul |
EUR 223 |
CAST Rabbit pAb |
|
A16789-100ul |
Abclonal |
100 ul |
EUR 308 |
CAST Rabbit pAb |
|
A16789-200ul |
Abclonal |
200 ul |
EUR 459 |
CAST Rabbit pAb |
|
A16789-20ul |
Abclonal |
20 ul |
EUR 183 |
CAST Rabbit pAb |
|
A16789-50ul |
Abclonal |
50 ul |
EUR 223 |
CAST Rabbit pAb |
|
A16790-100ul |
Abclonal |
100 ul |
EUR 308 |
CAST Rabbit pAb |
|
A16790-200ul |
Abclonal |
200 ul |
EUR 459 |
CAST Rabbit pAb |
|
A16790-20ul |
Abclonal |
20 ul |
EUR 183 |
CAST Rabbit pAb |
|
A16790-50ul |
Abclonal |
50 ul |
EUR 223 |
 Anti-CAST antibody |
|
STJ29949 |
St John's Laboratory |
100 µl |
EUR 413 |
|
Description: The protein encoded by this gene is an endogenous calpain (calcium-dependent cysteine protease) inhibitor. It consists of an N-terminal domain L and four repetitive calpain-inhibition domains (domains 1-4), and it is involved in the proteolysis of amyloid precursor protein. The calpain/calpastatin system is involved in numerous membrane fusion events, such as neural vesicle exocytosis and platelet and red-cell aggregation. The encoded protein is also thought to affect the expression levels of genes encoding structural or regulatory proteins. Alternatively spliced transcript variants encoding different isoforms have been described. |
Anti-CAST antibody |
|
STJ22910 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: The protein encoded by this gene is an endogenous calpain (calcium-dependent cysteine protease) inhibitor. It consists of an N-terminal domain L and four repetitive calpain-inhibition domains (domains 1-4), and it is involved in the proteolysis of amyloid precursor protein. The calpain/calpastatin system is involved in numerous membrane fusion events, such as neural vesicle exocytosis and platelet and red-cell aggregation. The encoded protein is also thought to affect the expression levels of genes encoding structural or regulatory proteins. Alternatively spliced transcript variants encoding different isoforms have been described. |
Anti-CAST antibody |
|
STJ115638 |
St John's Laboratory |
100 µl |
EUR 277 |
|
Description: The protein encoded by this gene is an endogenous calpain (calcium-dependent cysteine protease) inhibitor. It consists of an N-terminal domain L and four repetitive calpain-inhibition domains (domains 1-4), and it is involved in the proteolysis of amyloid precursor protein. The calpain/calpastatin system is involved in numerous membrane fusion events, such as neural vesicle exocytosis and platelet and red-cell aggregation. The encoded protein is also thought to affect the expression levels of genes encoding structural or regulatory proteins. Alternatively spliced transcript variants encoding different isoforms have been described. |
 Erc1 ELISA Kit| Mouse ELKS/Rab6-interacting/CAST family member |
|
EF014770 |
Lifescience Market |
96 Tests |
EUR 689 |
 Frit Kit |
|
FRIT-KIT |
Next Advance |
1each |
EUR 124 |
|
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool. |
 Calpastatin Polyclonal Conjugated Antibody |
|
C42103 |
SAB |
100ul |
EUR 397 |
) Calpastatin protein (Domain 1) |
|
30R-AC005 |
Fitzgerald |
1 mg |
EUR 635 |
|
Description: Purified recombinant Human Calpastatin protein (Domain 1) |
 Column Packing Kit |
|
PACK-KIT |
Next Advance |
1pack |
EUR 1035 |
|
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar. |
) Cast sgRNA CRISPR Lentivector set (Mouse) |
|
K3360001 |
ABM |
3 x 1.0 ug |
EUR 339 |
 PCR Mycoplasma Detection Kit |
|
M034-Kit |
TOKU-E |
Kit |
EUR 266 |
 ELISA Kit) Mouse ELKS/Rab6-Interacting/CAST Family Member 1 (ERC1) ELISA Kit |
|
abx389140-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
 Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit |
|
CAS400A-KIT |
SBI |
1 kit (10 rxn) |
EUR 1110 |
|
|
 CAST Polyclonal Conjugated Antibody |
|
C30990 |
SAB |
100ul |
EUR 397 |
 Rat CAST shRNA Plasmid |
|
20-abx984994 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Human CAST shRNA Plasmid |
|
20-abx950585 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 CAST Antibody, HRP conjugated |
|
1-CSB-PA004561YB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against CAST. Recognizes CAST from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
 CAST Antibody, FITC conjugated |
|
1-CSB-PA004561YC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against CAST. Recognizes CAST from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
 CAST Antibody, Biotin conjugated |
|
1-CSB-PA004561YD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against CAST. Recognizes CAST from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
) CAST Recombinant Protein (Human) |
|
RP005683 |
ABM |
100 ug |
Ask for price |
) CAST Recombinant Protein (Rat) |
|
RP193238 |
ABM |
100 ug |
Ask for price |
CAST Recombinant Protein (Rat) |
|
RP193241 |
ABM |
100 ug |
Ask for price |
CAST Recombinant Protein (Rat) |
|
RP193244 |
ABM |
100 ug |
Ask for price |
 CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
|
CASLV100PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
|
 CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
|
CASLV105PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
|
 MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
|
CASLV120PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
|
 MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
|
CASLV125PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
|
 (human)) Acetyl-Calpastatin (184-210) (human) |
|
H-4076.0500 |
Bachem |
0.5mg |
EUR 181 |
|
Description: Sum Formula: C142H230N36O44S; CAS# [123714-50-1] net |
Acetyl-Calpastatin (184-210) (human) |
|
H-4076.1000 |
Bachem |
1.0mg |
EUR 302 |
|
Description: Sum Formula: C142H230N36O44S; CAS# [123714-50-1] net |
Acetyl-Calpastatin (184-210) (human) |
|
A4410-1 |
ApexBio |
1 mg |
EUR 551 |
|
Description: Selective calpain inhibitor. Strongly inhibits calpain I (Ki = 0.2 nM) and II but does not inhibit papain, trypsin and cathepsin L (Ki = 6 ?M). Increases secretion of amyoid ?-protein (A?) 42, A?40 and A?42 ratio. |
 (human)) Ac-Calpastatin (184-210) (human) |
|
5-00551 |
CHI Scientific |
4 x 1mg |
Ask for price |
) Anti-Calpastatin Antibody (monoclonal, 14E12) |
|
M00337 |
BosterBio |
100ug/vial |
EUR 334 |
 Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
|
CAS700A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
|
 Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
|
CAS720A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
|
 Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
|
CAS740A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
|
 (Target 1)) Cast sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K3360002 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Cast sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K3360003 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Cast sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K3360004 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) CAST Protein Vector (Mouse) (pPB-C-His) |
|
PV161746 |
ABM |
500 ng |
EUR 1065 |
 (pPB-N-His)) CAST Protein Vector (Mouse) (pPB-N-His) |
|
PV161747 |
ABM |
500 ng |
EUR 1065 |
 (pPM-C-HA)) CAST Protein Vector (Mouse) (pPM-C-HA) |
|
PV161748 |
ABM |
500 ng |
EUR 1065 |
 (pPM-C-His)) CAST Protein Vector (Mouse) (pPM-C-His) |
|
PV161749 |
ABM |
500 ng |
EUR 1065 |
) T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents) |
|
CAS510A-KIT |
SBI |
1 Kit |
EUR 805 |
|
|
-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit) Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
|
CASLV200PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
|
-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit) Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
|
CASLV205PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
|
-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit) Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
|
CASLV220PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
|
-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit) Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
|
CASLV225PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
|
 casting base |
|
EHS3100-CAST |
Consort |
ea |
EUR 107 |
casting base |
|
EHS3200-CAST |
Consort |
ea |
EUR 124 |
casting base |
|
EHS3300-CAST |
Consort |
ea |
EUR 124 |
 gelcaster for sequencer |
|
ESEQ1000-CAST |
Consort |
ea |
EUR 437 |
 Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector |
|
CAS750A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
|
 Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector |
|
CAS770A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
|
 Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector |
|
CAS790A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
|
 and Fast ligase (2.5ul)]) Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)] |
|
CAS9LIG-KIT |
SBI |
1 Kit |
EUR 153 |
|
|
) PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1) |
|
PIN320A-KIT |
SBI |
1 Kit |
EUR 4941 |
- Category: PinPoint Integrase Tools
|
) PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1) |
|
PIN340iPS-KIT |
SBI |
1 Kit |
EUR 4941 |
- Category: PinPoint Integrase Tools
|
 CAST Polyclonal Antibody, Biotin Conjugated |
|
A54653 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: Ask the seller for details |
 CAST Polyclonal Antibody, FITC Conjugated |
|
A54654 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: The best epigenetics products |
 CAST Polyclonal Antibody, HRP Conjugated |
|
A54655 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: kits suitable for this type of research |
 [KO Validated] CAST Rabbit pAb |
|
A7634-100ul |
Abclonal |
100 ul |
EUR 410 |
Mouse CAST(Calpastatin) ELISA Kit
ELISA Kit)
