Mouse FUS(Fusion) ELISA Kit

Mouse FUS(Fusion) ELISA Kit

Mouse Fusion (FUS) ELISA Kit

RD-FUS-Mu-96Tests 96 Tests
EUR 740

Mouse Fusion (FUS) ELISA Kit

RDR-FUS-Mu-48Tests 48 Tests
EUR 557

Mouse Fusion (FUS) ELISA Kit

RDR-FUS-Mu-96Tests 96 Tests
EUR 774

Human Fusion (FUS) ELISA Kit

DLR-FUS-Hu-48T 48T
EUR 517
  • Should the Human Fusion (FUS) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Fusion (FUS) in samples from tissue homogenates or other biological fluids.

Human Fusion (FUS) ELISA Kit

DLR-FUS-Hu-96T 96T
EUR 673
  • Should the Human Fusion (FUS) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Fusion (FUS) in samples from tissue homogenates or other biological fluids.

Human Fusion (FUS) ELISA Kit

RD-FUS-Hu-48Tests 48 Tests
EUR 521

Human Fusion (FUS) ELISA Kit

RD-FUS-Hu-96Tests 96 Tests
EUR 723

Human Fusion (FUS) ELISA Kit

RDR-FUS-Hu-48Tests 48 Tests
EUR 544

Human Fusion (FUS) ELISA Kit

RDR-FUS-Hu-96Tests 96 Tests
EUR 756

Mouse Fusion (FUS) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Fusion (FUS) ELISA Kit

SEC260Mu-10x96wellstestplate 10x96-wells test plate
EUR 4862.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Fusion (FUS) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Fusion (FUS) in Tissue homogenates and other biological fluids.

Mouse Fusion (FUS) ELISA Kit

SEC260Mu-1x48wellstestplate 1x48-wells test plate
EUR 488.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Fusion (FUS) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Fusion (FUS) in Tissue homogenates and other biological fluids.

Mouse Fusion (FUS) ELISA Kit

SEC260Mu-1x96wellstestplate 1x96-wells test plate
EUR 654.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Fusion (FUS) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Fusion (FUS) in Tissue homogenates and other biological fluids.

Mouse Fusion (FUS) ELISA Kit

SEC260Mu-5x96wellstestplate 5x96-wells test plate
EUR 2644.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Fusion (FUS) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Fusion (FUS) in Tissue homogenates and other biological fluids.

Mouse Fusion (FUS) ELISA Kit

  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Fusion elisa. Alternative names of the recognized antigen: CHOP
  • ALS6
  • TLS
  • hnRNP-P2
  • Amyotrophic Lateral Sclerosis 6
  • Heterogeneous Nuclear Ribonucleoprotein P2
  • 75 kDa DNA-pairing protein
  • Translocated in liposarcoma protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Fusion (FUS) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

ELISA kit for Mouse FUS (Fusion)

ELK6109 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Fusion (FUS). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Fusion (FUS). Next, A
  • Show more
Description: A sandwich ELISA kit for detection of Fusion from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Mouse Fusion (FUS) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Fusion (FUS) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Fusion (FUS) ELISA Kit

SEC260Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fusion (FUS) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Fusion (FUS) in tissue homogenates, cell lysates and other biological fluids.

Human Fusion (FUS) ELISA Kit

SEC260Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fusion (FUS) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Fusion (FUS) in tissue homogenates, cell lysates and other biological fluids.

Human Fusion (FUS) ELISA Kit

SEC260Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fusion (FUS) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Fusion (FUS) in tissue homogenates, cell lysates and other biological fluids.

Human Fusion (FUS) ELISA Kit

SEC260Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Fusion (FUS) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Fusion (FUS) in tissue homogenates, cell lysates and other biological fluids.

Human Fusion (FUS) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Fusion elisa. Alternative names of the recognized antigen: CHOP
  • ALS6
  • TLS
  • hnRNP-P2
  • Amyotrophic Lateral Sclerosis 6
  • Heterogeneous Nuclear Ribonucleoprotein P2
  • 75 kDa DNA-pairing protein
  • Translocated in liposarcoma protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Fusion (FUS) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Fusion ELISA Kit (FUS)

RK01425 96 Tests
EUR 521

Human Fusion(FUS)ELISA Kit

QY-E01737 96T
EUR 361

Mouse Fusion (FUS) Protein

  • EUR 704.00
  • EUR 286.00
  • EUR 2165.00
  • EUR 829.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Fusion (FUS) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Fusion (FUS) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Fusion (FUS) Antibody

  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Fusion (FUS) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Fusion (FUS) Antibody

  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Fusion (FUS) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Fusion (FUS) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Recombinant Fusion (FUS)

  • EUR 467.36
  • EUR 228.00
  • EUR 1477.60
  • EUR 559.20
  • EUR 1018.40
  • EUR 376.00
  • EUR 3544.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P35637
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 29.2kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Fusion expressed in: E.coli

Recombinant Fusion (FUS)

  • EUR 503.20
  • EUR 238.00
  • EUR 1612.00
  • EUR 604.00
  • EUR 1108.00
  • EUR 400.00
  • EUR 3880.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P56959
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 53.3kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Fusion expressed in: E.coli

ELISA kit for Human FUS (Fusion)

ELK4043 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Fusion (FUS). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Fusion (FUS). Next, A
  • Show more
Description: A sandwich ELISA kit for detection of Fusion from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Fusion (FUS) Polyclonal Antibody (Mouse)

  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FUS (Ser3~Arg267)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Fusion (FUS)

Human Fusion (FUS) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Fusion (FUS) Protein

  • EUR 648.00
  • EUR 272.00
  • EUR 1998.00
  • EUR 773.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Fusion (FUS) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Fusion (FUS) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Fusion (FUS) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Fusion (FUS) Antibody (FITC)

  • EUR 495.00
  • EUR 258.00
  • EUR 1455.00
  • EUR 676.00
  • EUR 398.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Fusion (FUS) Antibody (Biotin)

  • EUR 467.00
  • EUR 244.00
  • EUR 1344.00
  • EUR 634.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Fusion (FUS) Polyclonal Antibody (Mouse), APC

  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FUS (Ser3~Arg267)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Fusion (FUS). This antibody is labeled with APC.

Fusion (FUS) Polyclonal Antibody (Mouse), Biotinylated

  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FUS (Ser3~Arg267)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Fusion (FUS). This antibody is labeled with Biotin.

Fusion (FUS) Polyclonal Antibody (Mouse), Cy3

  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FUS (Ser3~Arg267)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Fusion (FUS). This antibody is labeled with Cy3.

Fusion (FUS) Polyclonal Antibody (Mouse), FITC

  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FUS (Ser3~Arg267)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Fusion (FUS). This antibody is labeled with FITC.

Fusion (FUS) Polyclonal Antibody (Mouse), HRP

  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FUS (Ser3~Arg267)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Fusion (FUS). This antibody is labeled with HRP.

Fusion (FUS) Polyclonal Antibody (Mouse), PE

  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FUS (Ser3~Arg267)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Fusion (FUS). This antibody is labeled with PE.

Fusion (FUS) Polyclonal Antibody (Human)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FUS (Gly193~Cys444)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fusion (FUS)

Fusion (FUS) Polyclonal Antibody (Mouse), APC-Cy7

  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FUS (Ser3~Arg267)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Fusion (FUS). This antibody is labeled with APC-Cy7.

Fusion (FUS) Polyclonal Antibody (Human), APC

  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FUS (Gly193~Cys444)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fusion (FUS). This antibody is labeled with APC.

Fusion (FUS) Polyclonal Antibody (Human), Biotinylated

  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FUS (Gly193~Cys444)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fusion (FUS). This antibody is labeled with Biotin.

Fusion (FUS) Polyclonal Antibody (Human), Cy3

  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FUS (Gly193~Cys444)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fusion (FUS). This antibody is labeled with Cy3.

Fusion (FUS) Polyclonal Antibody (Human), FITC

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FUS (Gly193~Cys444)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fusion (FUS). This antibody is labeled with FITC.

Fusion (FUS) Polyclonal Antibody (Human), HRP

  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FUS (Gly193~Cys444)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fusion (FUS). This antibody is labeled with HRP.

Fusion (FUS) Polyclonal Antibody (Human), PE

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FUS (Gly193~Cys444)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fusion (FUS). This antibody is labeled with PE.

Fusion (FUS) Polyclonal Antibody (Human), APC-Cy7

  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: FUS (Gly193~Cys444)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Fusion (FUS). This antibody is labeled with APC-Cy7.

Mouse RNA-Binding Protein FUS (FUS) ELISA Kit

abx570765-96tests 96 tests
EUR 668
  • Shipped within 1-3 weeks.

Mouse RNA- binding protein FUS, Fus ELISA KIT

ELI-48335m 96 Tests
EUR 865

Fus ELISA Kit| Mouse RNA-binding protein FUS ELISA Kit

EF014989 96 Tests
EUR 689

FUS ELISA Kit| Bovine RNA-binding protein FUS ELISA Kit

EF011406 96 Tests
EUR 689

Cow RNA-Binding Protein FUS (FUS) ELISA Kit

abx555793-96tests 96 tests
EUR 911
  • Shipped within 1-3 weeks.

Human RNA-Binding Protein FUS (FUS) ELISA Kit

abx571353-96tests 96 tests
EUR 739
  • Shipped within 1-3 weeks.

Human FUS/ RNA-binding protein FUS ELISA Kit

E0955Hu 1 Kit
EUR 605

Human FUS(RNA-binding protein FUS) ELISA Kit

EH14546 96T
EUR 567.6
  • Detection range: 78.125-5000 pg/ml
  • Uniprot ID: P35637
  • Alias: 75 kDa DNA-pairing protein/Oncogene FUS/Oncogene TLS/POMp75/Translocated in liposarcoma protein/TLS
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.875pg/ml

Human RNA- binding protein FUS, FUS ELISA KIT

ELI-20697h 96 Tests
EUR 824

Bovine RNA- binding protein FUS, FUS ELISA KIT

ELI-30802b 96 Tests
EUR 928


EF006746 96 Tests
EUR 689

Human RNA-binding protein FUS (FUS/TLS) ELISA kit

CSB-E17376h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human RNA-binding protein FUS (FUS/TLS) in samples from serum, plasma, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human RNA-binding protein FUS (FUS/TLS) ELISA kit

  • EUR 900.00
  • EUR 5476.00
  • EUR 2900.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human RNA-binding protein FUS (FUS/TLS) in samples from serum, plasma, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202

Mouse FUS shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

FUS Recombinant Protein (Mouse)

RP135407 100 ug Ask for price

RNA-Binding Protein FUS (FUS) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

RNA-Binding Protein FUS (FUS) Antibody

abx037843-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

RNA-Binding Protein FUS (FUS) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FUS antibody

70R-4766 50 ug
EUR 467
Description: Rabbit polyclonal FUS antibody raised against the N terminal of FUS

FUS Antibody

ABD8391 100 ug
EUR 438

FUS Antibody

ABD8420 100 ug
EUR 438

FUS Antibody

EUR 316

Fus Antibody

39335-100ul 100ul
EUR 390

FUS Antibody

42783-100ul 100ul
EUR 252

FUS Antibody

40153-100ul 100ul
EUR 252

FUS antibody

70R-17367 50 ul
EUR 435
Description: Rabbit polyclonal FUS antibody

FUS antibody

70R-12072 100 ul
EUR 403
Description: Rabbit polyclonal FUS antibody

FUS antibody

70R-15452 100 ug
EUR 327
Description: Rabbit polyclonal FUS antibody

FUS Antibody

DF8391 200ul
EUR 304
Description: FUS Antibody detects endogenous levels of total FUS.

FUS Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against FUS. Recognizes FUS from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:30-1:150

FUS Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against FUS. Recognizes FUS from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:30-1:150

FUS Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against FUS. Recognizes FUS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

FUS Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FUS. Recognizes FUS from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200, IF:1:50-1:200


PVT18731 2 ug
EUR 231

RNA-Binding Protein FUS (FUS) Antibody Pair

abx117338-1pair5x96wellplates 1 pair (5x96 well plates)
EUR 1010
  • Shipped within 5-10 working days.

Fus ORF Vector (Mouse) (pORF)

ORF045137 1.0 ug DNA
EUR 506

Mouse CHRNA7 FAM7A fusion protein(CHRFAM7A) ELISA kit

E03C1702-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse CHRNA7 FAM7A fusion protein(CHRFAM7A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse CHRNA7 FAM7A fusion protein(CHRFAM7A) ELISA kit

E03C1702-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse CHRNA7 FAM7A fusion protein(CHRFAM7A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse CHRNA7 FAM7A fusion protein(CHRFAM7A) ELISA kit

E03C1702-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse CHRNA7 FAM7A fusion protein(CHRFAM7A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Lipoma HMGIC fusion partner, Lhfp ELISA KIT

ELI-38811m 96 Tests
EUR 865

Mouse TCF3 fusion partner homolog, Tfpt ELISA KIT

ELI-41794m 96 Tests
EUR 865

Polyclonal FUS Antibody

APR00190G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human FUS . This antibody is tested and proven to work in the following applications:

FUS Conjugated Antibody

C40153 100ul
EUR 397

FUS cloning plasmid

CSB-CL009069HU-10ug 10ug
EUR 552
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1581
  • Sequence: atggcctcaaacgattatacccaacaagcaacccaaagctatggggcctaccccacccagcccgggcagggctattcccagcagagcagtcagccctacggacagcagagttacagtggttatagccagtccacggacacttcaggctatggccagagcagctattcttcttatg
  • Show more
Description: A cloning plasmid for the FUS gene.

FUS / TLS Antibody

abx233242-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

FUS / TLS Antibody

abx233243-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

FUS Polyclonal Antibody

A51449 100 µg
EUR 570.55
Description: fast delivery possible

FUS Blocking Peptide

33R-5753 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of FUS antibody, catalog no. 70R-4766

FUS/TLS Antibody

49300-100ul 100ul
EUR 333

FUS/TLS Antibody

49300-50ul 50ul
EUR 239

FUS antibody (HRP)

60R-2170 100 ug
EUR 327
Description: Rabbit polyclonal FUS antibody (HRP)

FUS antibody (FITC)

60R-2171 100 ug
EUR 327
Description: Rabbit polyclonal FUS antibody (FITC)

FUS antibody (biotin)

60R-2172 100 ug
EUR 327
Description: Rabbit polyclonal FUS antibody (biotin)

FUS Blocking Peptide

DF8391-BP 1mg
EUR 195

pASK- IBA5plus++FUS

PVT10149 2 ug
EUR 266

Anti-FUS antibody

STJ27717 100 µl
EUR 413
Description: This gene encodes a multifunctional protein component of the heterogeneous nuclear ribonucleoprotein (hnRNP) complex. The hnRNP complex is involved in pre-mRNA splicing and the export of fully processed mRNA to the cytoplasm. This protein belongs to the FET family of RNA-binding proteins which have been implicated in cellular processes that include regulation of gene expression, maintenance of genomic integrity and mRNA/microRNA processing. Alternative splicing results in multiple transcript variants. Defects in this gene result in amyotrophic lateral sclerosis type 6.

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

ELISA kit for Human RNA-binding protein FUS

EK3746 96 tests
EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Human RNA-binding protein FUS in samples from serum, plasma, tissue homogenates and other biological fluids.

Mouse Izumo Sperm-Egg Fusion 1 (IZUMO1) ELISA Kit

abx517781-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Mouse Vacuolar fusion protein CCZ1 homolog, Ccz1 ELISA KIT

ELI-24920m 96 Tests
EUR 865

Fus sgRNA CRISPR Lentivector set (Mouse)

K3765001 3 x 1.0 ug
EUR 339

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

Human TCF3 fusion partner, TFPT ELISA KIT

ELI-37062h 96 Tests
EUR 824

Human TCF3 Fusion Partner (TFPT) ELISA Kit

abx383724-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

FUS/TLS Conjugated Antibody

C49300 100ul
EUR 397

FUS Polyclonal Conjugated Antibody

C30674 100ul
EUR 397

anti- FUS/TLS antibody

FNab03242 100µg
EUR 505.25
  • Immunogen: fusion(involved in t(12
  • 16) in malignant liposarcoma)
  • Uniprot ID: P35637
  • Research Area: Neuroscience, Cancer
Description: Antibody raised against FUS/TLS

anti- FUS/TLS antibody

FNab03243 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:2000
  • IP: 1:5000-1:50000
  • IHC: 1:500-1:2500
  • IF: 1:20-1:200
  • Immunogen: fusion(involved in t(12
  • 16) in malignant liposarcoma)
  • Uniprot ID: P35637
  • Research Area: Neuroscience, Cancer
Description: Antibody raised against FUS/TLS

Anti-TLS/FUS Antibody

A00771-1 100ug/vial
EUR 294

Human FUS shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

FUS Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FUS. Recognizes FUS from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

FUS Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FUS. Recognizes FUS from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

FUS Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FUS. Recognizes FUS from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-FUS/TLS antibody

PAab03242 100 ug
EUR 355

FUS Recombinant Protein (Human)

RP012655 100 ug Ask for price

FUS Recombinant Protein (Rat)

RP201878 100 ug Ask for price

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

Mouse Vacuolar fusion protein MON1 homolog A(MON1A) ELISA kit

E03V0065-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Vacuolar fusion protein MON1 homolog A(MON1A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Vacuolar fusion protein MON1 homolog A(MON1A) ELISA kit

E03V0065-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Vacuolar fusion protein MON1 homolog A(MON1A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Vacuolar fusion protein MON1 homolog A(MON1A) ELISA kit

E03V0065-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Vacuolar fusion protein MON1 homolog A(MON1A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Vacuolar fusion protein MON1 homolog A, Mon1a ELISA KIT

ELI-23201m 96 Tests
EUR 865

Mouse Izumo sperm- egg fusion protein 1, Izumo1 ELISA KIT

ELI-05119m 96 Tests
EUR 865

Mouse Vacuolar fusion protein MON1 homolog B, Mon1b ELISA KIT

ELI-46331m 96 Tests
EUR 865

Mouse Izumo sperm- egg fusion protein 3, Izumo3 ELISA KIT

ELI-31200m 96 Tests
EUR 865

Mouse Izumo sperm- egg fusion protein 2, Izumo2 ELISA KIT

ELI-39422m 96 Tests
EUR 865

Fus sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3765002 1.0 ug DNA
EUR 154

Fus sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3765003 1.0 ug DNA
EUR 154

Fus sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3765004 1.0 ug DNA
EUR 154

FUS Protein Vector (Mouse) (pPB-C-His)

PV180546 500 ng
EUR 603

FUS Protein Vector (Mouse) (pPB-N-His)

PV180547 500 ng
EUR 603

FUS Protein Vector (Mouse) (pPM-C-HA)

PV180548 500 ng
EUR 603

FUS Protein Vector (Mouse) (pPM-C-His)

PV180549 500 ng
EUR 603

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS700A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS720A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS740A-KIT 10 rxn
EUR 1132
  • Category: Cas9

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS750A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS770A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS790A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]

EUR 153
  • Category: Cas9

Goat CHRNA7 FAM7A fusion protein(CHRFAM7A) ELISA kit

E06C1702-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat CHRNA7 FAM7A fusion protein(CHRFAM7A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat CHRNA7 FAM7A fusion protein(CHRFAM7A) ELISA kit

E06C1702-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat CHRNA7 FAM7A fusion protein(CHRFAM7A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat CHRNA7 FAM7A fusion protein(CHRFAM7A) ELISA kit

E06C1702-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat CHRNA7 FAM7A fusion protein(CHRFAM7A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat CHRNA7 FAM7A fusion protein(CHRFAM7A) ELISA kit

E02C1702-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat CHRNA7 FAM7A fusion protein(CHRFAM7A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat CHRNA7 FAM7A fusion protein(CHRFAM7A) ELISA kit

E02C1702-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat CHRNA7 FAM7A fusion protein(CHRFAM7A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat CHRNA7 FAM7A fusion protein(CHRFAM7A) ELISA kit

E02C1702-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat CHRNA7 FAM7A fusion protein(CHRFAM7A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit CHRNA7 FAM7A fusion protein(CHRFAM7A) ELISA kit

E04C1702-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit CHRNA7 FAM7A fusion protein(CHRFAM7A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit CHRNA7 FAM7A fusion protein(CHRFAM7A) ELISA kit

E04C1702-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit CHRNA7 FAM7A fusion protein(CHRFAM7A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit CHRNA7 FAM7A fusion protein(CHRFAM7A) ELISA kit

E04C1702-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit CHRNA7 FAM7A fusion protein(CHRFAM7A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human CHRNA7 FAM7A fusion protein(CHRFAM7A) ELISA kit

E01C1702-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human CHRNA7 FAM7A fusion protein(CHRFAM7A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human CHRNA7 FAM7A fusion protein(CHRFAM7A) ELISA kit

E01C1702-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human CHRNA7 FAM7A fusion protein(CHRFAM7A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human CHRNA7 FAM7A fusion protein(CHRFAM7A) ELISA kit

E01C1702-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human CHRNA7 FAM7A fusion protein(CHRFAM7A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Izumo Sperm Egg Fusion 1 ELISA Kit

ELA-E3966h 96 Tests
EUR 824

Pig CHRNA7 FAM7A fusion protein(CHRFAM7A) ELISA kit

E07C1702-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine CHRNA7 FAM7A fusion protein(CHRFAM7A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig CHRNA7 FAM7A fusion protein(CHRFAM7A) ELISA kit

E07C1702-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine CHRNA7 FAM7A fusion protein(CHRFAM7A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig CHRNA7 FAM7A fusion protein(CHRFAM7A) ELISA kit

E07C1702-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine CHRNA7 FAM7A fusion protein(CHRFAM7A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog CHRNA7 FAM7A fusion protein(CHRFAM7A) ELISA kit

E08C1702-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine CHRNA7 FAM7A fusion protein(CHRFAM7A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog CHRNA7 FAM7A fusion protein(CHRFAM7A) ELISA kit

E08C1702-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine CHRNA7 FAM7A fusion protein(CHRFAM7A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog CHRNA7 FAM7A fusion protein(CHRFAM7A) ELISA kit

E08C1702-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine CHRNA7 FAM7A fusion protein(CHRFAM7A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey CHRNA7 FAM7A fusion protein(CHRFAM7A) ELISA kit

E09C1702-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey CHRNA7 FAM7A fusion protein(CHRFAM7A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey CHRNA7 FAM7A fusion protein(CHRFAM7A) ELISA kit

E09C1702-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey CHRNA7 FAM7A fusion protein(CHRFAM7A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey CHRNA7 FAM7A fusion protein(CHRFAM7A) ELISA kit

E09C1702-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey CHRNA7 FAM7A fusion protein(CHRFAM7A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Bovine TCF3 fusion partner homolog, TFPT ELISA KIT

ELI-18981b 96 Tests
EUR 928

Human CHRNA7- FAM7A fusion protein, CHRFAM7A ELISA KIT

ELI-26298h 96 Tests
EUR 824

Human Lipoma HMGIC fusion partner, LHFP ELISA KIT

ELI-43189h 96 Tests
EUR 824

Human CHRNA7-FAM7A Fusion Protein (CHRFAM7A) ELISA Kit

abx386514-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

[KO Validated] FUS Rabbit pAb

A5921-100ul 100 ul
EUR 410

[KO Validated] FUS Rabbit pAb

A5921-200ul 200 ul
EUR 571

[KO Validated] FUS Rabbit pAb

A5921-20ul 20 ul
EUR 221

[KO Validated] FUS Rabbit pAb

A5921-50ul 50 ul
EUR 287

FUS/TLS recombinant monoclonal antibody

A5383 100ul X 3
EUR 595
  • Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
  • Show more
Description: A recombinant monoclonal antibody from rabbit against human FUS/TLS for WB,ELISA

FUS Polyclonal Antibody, HRP Conjugated

A51450 100 µg
EUR 570.55
Description: reagents widely cited

FUS Polyclonal Antibody, FITC Conjugated

A51451 100 µg
EUR 570.55
Description: Ask the seller for details

FUS Polyclonal Antibody, Biotin Conjugated

A51452 100 µg
EUR 570.55
Description: The best epigenetics products

[KO Validated] FUS Polyclonal Antibody

30674-100ul 100ul
EUR 252

[KO Validated] FUS Polyclonal Antibody

30674-50ul 50ul
EUR 187

FUS ORF Vector (Human) (pORF)

ORF004219 1.0 ug DNA
EUR 95

Fus ORF Vector (Rat) (pORF)

ORF067294 1.0 ug DNA
EUR 506

ig-Fusion Cloning Kit - 10 Reactions

4111 1/EA
EUR 263

ig-Fusion Cloning Kit - 50 Reactions

4115 1/EA
EUR 846

ig-Fusion Cloning Kit - 100 Reactions

4117 1/EA
EUR 1334

AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE620A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE622A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE624A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

Rat Izumo Sperm-Egg Fusion 1 (IZUMO1) ELISA Kit

abx517782-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Mouse FUS(Fusion) ELISA Kit