Mouse GNb1(G Protein Beta 1) ELISA Kit

Mouse GNb1(G Protein Beta 1) ELISA Kit

Mouse G Protein Beta 1 (GNb1) ELISA Kit

RD-GNb1-Mu-96Tests 96 Tests
EUR 740

Mouse G Protein Beta 1 (GNb1) ELISA Kit

RDR-GNb1-Mu-48Tests 48 Tests
EUR 557

Mouse G Protein Beta 1 (GNb1) ELISA Kit

RDR-GNb1-Mu-96Tests 96 Tests
EUR 774

Mouse GNb1(G Protein Beta 1) ELISA Kit

EM1080 96T
EUR 524.1
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: P62874
  • Alias: GNb1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 0.094 ng/ml

Mouse G Protein beta 1 (GNb1) ELISA Kit

20-abx154046
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse G Protein Beta 1 (GNb1) ELISA Kit

abx254133-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Mouse G Protein Beta 1 (GNb1) ELISA Kit

SEC503Mu-10x96wellstestplate 10x96-wells test plate
EUR 4862.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse G Protein Beta 1 (GNb1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse G Protein Beta 1 (GNb1) in Tissue homogenates and other biological fluids.

Mouse G Protein Beta 1 (GNb1) ELISA Kit

SEC503Mu-1x48wellstestplate 1x48-wells test plate
EUR 488.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse G Protein Beta 1 (GNb1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse G Protein Beta 1 (GNb1) in Tissue homogenates and other biological fluids.

Mouse G Protein Beta 1 (GNb1) ELISA Kit

SEC503Mu-1x96wellstestplate 1x96-wells test plate
EUR 654.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse G Protein Beta 1 (GNb1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse G Protein Beta 1 (GNb1) in Tissue homogenates and other biological fluids.

Mouse G Protein Beta 1 (GNb1) ELISA Kit

SEC503Mu-5x96wellstestplate 5x96-wells test plate
EUR 2644.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse G Protein Beta 1 (GNb1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse G Protein Beta 1 (GNb1) in Tissue homogenates and other biological fluids.

Mouse G Protein Beta 1 (GNb1) ELISA Kit

4-SEC503Mu
  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as G Protein Beta 1 elisa. Alternative names of the recognized antigen: GN-B1
  • Guanine Nucleotide Binding Protein Beta 1
  • Transducin beta chain 1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse G Protein Beta 1 (GNb1) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Mouse G Protein Beta 1 (GNb1) Protein

20-abx653481
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Mouse G Protein Beta 1 (GNb1) Protein

20-abx653482
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

ELISA kit for Mouse GNb1 (G Protein Beta 1)

E-EL-M0523 1 plate of 96 wells
EUR 534
  • Gentaur's GNb1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse GNb1. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Mouse GNb1 (G Protein Beta 1) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Mouse GNb1 (G Protein Beta 1)

ELK6097 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to G Protein Beta 1 (GNb1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to G Protein
  • Show more
Description: A sandwich ELISA kit for detection of G Protein Beta 1 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

GNb1 ELISA Kit| Mouse G Protein Beta 1 ELISA Kit

EF013648 96 Tests
EUR 689

Mouse G Protein beta 1 (GNb1) CLIA Kit

20-abx493738
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Mouse G Protein Beta 1 (GNb1) CLIA Kit

abx196963-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Pig G Protein Beta 1 (GNb1) ELISA Kit

abx360690-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rabbit G Protein Beta 1 (GNb1) ELISA Kit

abx363694-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rat G Protein Beta 1 (GNb1) ELISA Kit

abx353670-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.

Monkey G Protein Beta 1 (GNb1) ELISA Kit

abx358927-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Chicken G Protein Beta 1 (GNb1) ELISA Kit

abx355831-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Human G Protein Beta 1 (GNb1) ELISA Kit

abx252555-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

G Protein Beta 1 (GNB1) Antibody

20-abx125888
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

G Protein Beta 1 (GNB1) Antibody

20-abx112891
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

G Protein Beta 1 (GNB1) Antibody

abx036181-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

G Protein Beta 1 (GNB1) Antibody

abx032387-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

G Protein Beta 1 (GNB1) Antibody

abx032387-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

G Protein Beta 1 (GNb1) Antibody

20-abx176522
  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

G Protein Beta 1 (GNb1) Antibody

20-abx176523
  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

G Protein Beta 1 (GNB1) Antibody

20-abx318748
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

G Protein Beta 1 (GNB1) Antibody

20-abx241877
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

G Protein Beta 1 (GNB1) Antibody

20-abx241878
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

G Protein Beta 1 (GNB1) Peptide

20-abx262764
  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

G Protein Beta 1 (GNB1) Antibody

abx233538-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

CLIA kit for Mouse GNb1 (G Protein Beta 1)

E-CL-M0315 1 plate of 96 wells
EUR 584
  • Gentaur's GNb1 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Mouse GNb1 . Standards or samples are added to the micro CLIA plate wells and combined with the
  • Show more
Description: A sandwich CLIA kit for quantitative measurement of Mouse GNb1 (G Protein Beta 1) in samples from Serum, Plasma, Cell supernatant

Guinea pig G Protein Beta 1 (GNb1) ELISA Kit

abx357472-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

ELISA kit for Rat GNb1 (G Protein Beta 1)

E-EL-R0393 1 plate of 96 wells
EUR 534
  • Gentaur's GNb1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rat GNb1. Standards or samples are added to the micro ELISA plate wells and combined with the
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Rat GNb1 (G Protein Beta 1) in samples from Serum, Plasma, Cell supernatant

Human G Protein Beta 1 (GNb1) CLIA Kit

abx196668-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rat G Protein Beta 1 (GNb1) CLIA Kit

abx196964-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

G Protein Beta 1 (GNB1) Antibody (HRP)

20-abx316917
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

G Protein Beta 1 (GNB1) Antibody (FITC)

20-abx316918
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

G Protein Beta 1 (GNB1) Antibody (Biotin)

20-abx316919
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

CLIA kit for Rat GNb1 (G Protein Beta 1)

E-CL-R0257 1 plate of 96 wells
EUR 584
  • Gentaur's GNb1 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Rat GNb1 . Standards or samples are added to the micro CLIA plate wells and combined with the sp
  • Show more
Description: A sandwich CLIA kit for quantitative measurement of Rat GNb1 (G Protein Beta 1) in samples from Serum, Plasma, Cell supernatant

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

Gnb1/ Rat Gnb1 ELISA Kit

ELI-09679r 96 Tests
EUR 886

Mouse Gnb1 ELISA KIT

ELI-47371m 96 Tests
EUR 865

Mouse GNb1 ELISA Kit

EMG0217 96Tests
EUR 521

Mouse Interleukin-1 beta (IL-1 beta) AssayMax ELISA Kit

EMI2200-1 96 Well Plate
EUR 477

Anti-G beta 5 Antibody

A06754-1 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for G beta 5 Antibody (GNB5) detection.tested for WB in Human, Mouse, Rat.

Human GNβ1(G Protein Beta 1) ELISA Kit

EH3156 96T
EUR 524.1
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: P62873
  • Alias: GNβ1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Interleukin-1 beta (IL-1 beta) AssayMax ELISA Kit

EI2200-1 96 Well Plate
EUR 477

Human GNb1 ELISA Kit

EHG0217 96Tests
EUR 521

Goat GNb1 ELISA Kit

EGTG0217 96Tests
EUR 521

Canine GNb1 ELISA Kit

ECG0217 96Tests
EUR 521

Chicken GNb1 ELISA Kit

ECKG0217 96Tests
EUR 521

Bovine GNb1 ELISA Kit

EBG0217 96Tests
EUR 521

Anserini GNb1 ELISA Kit

EAG0217 96Tests
EUR 521

Human GNB1 ELISA KIT

ELI-27205h 96 Tests
EUR 824

Canine GNB1 ELISA KIT

ELI-27307d 96 Tests
EUR 928

Porcine GNb1 ELISA Kit

EPG0217 96Tests
EUR 521

Rat GNb1 ELISA Kit

ERG0217 96Tests
EUR 521

Rabbit GNb1 ELISA Kit

ERTG0217 96Tests
EUR 521

Sheep GNb1 ELISA Kit

ESG0217 96Tests
EUR 521

Bovine GNB1 ELISA KIT

ELI-48364b 96 Tests
EUR 928

Monkey GNb1 ELISA Kit

EMKG0217 96Tests
EUR 521

GNB1 Recombinant Protein (Mouse)

RP138956 100 ug Ask for price

GNB1 Recombinant Protein (Mouse)

RP138959 100 ug Ask for price

GNB1 Recombinant Protein (Mouse)

RP138962 100 ug Ask for price

IL-1-beta Interleukin-1 beta Mouse Recombinant Protein, His Tag

PROTP10749-1 Regular: 25ug
EUR 317
Description: Interleukin-1 beta Mouse Recombinant produced in E.Coli is a non-glycosylated, Polypeptide chain containing 189 amino acids and having a molecular mass of 21 kDa. ;The IL-1b is fused to His-Tag and purified by proprietary chromatographic techniques.

Protein G

6510-1
EUR 147

ELISA kit for Human GN?1 (G Protein Beta 1)

E-EL-H0886 1 plate of 96 wells
EUR 534
  • Gentaur's GN?1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human GN?1. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human GN?1 (G Protein Beta 1) in samples from Serum, Plasma, Cell supernatant

Human TGF-beta-1 AssayMax ELISA Kit

ET3102-1 96 Well Plate
EUR 477

GNB1 Guanine Nucleotide Binding Protein Beta Polypeptide 1 Human Recombinant Protein

PROTP62873 Regular: 10ug
EUR 317
Description: GNB1 Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 363 amino acids (1-340) and having a molecular mass of 39.8 kDa.;GNB1 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Guinea Pig GNb1 ELISA Kit

EGG0217 96Tests
EUR 521

Human Cathepsin G AssayMax ELISA Kit

EC3237-1 96 Well Plate
EUR 477

Mouse G Protein β 1 ELISA kit

E03G0210-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse G Protein β 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse G Protein β 1 ELISA kit

E03G0210-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse G Protein β 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse G Protein β 1 ELISA kit

E03G0210-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse G Protein β 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Protein A/G

6502-1
EUR 153

Protein G Sepharose

6511-1
EUR 191

Protein A/G

P1090-1 1 mg
EUR 168
Description: Protein A is a 42 kDa surface protein originally found in the cell wall of the bacterium Staphylococcus aureus. It can bind immunoglobulins. Protein G is an immunoglobulin-binding protein expressed in group C and G Streptococcal bacteria.

Goat Immunoglobulin G (IgG) ELISA Kit

DLR-IgG-g-48T 48T
EUR 464
  • Should the Goat Immunoglobulin G (IgG) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Goat Immunoglobulin G (IgG) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Goat Immunoglobulin G (IgG) ELISA Kit

DLR-IgG-g-96T 96T
EUR 601
  • Should the Goat Immunoglobulin G (IgG) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Goat Immunoglobulin G (IgG) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Goat Immunoglobulin G (IgG) ELISA Kit

RDR-IgG-g-48Tests 48 Tests
EUR 482

Goat Immunoglobulin G (IgG) ELISA Kit

RDR-IgG-g-96Tests 96 Tests
EUR 667

Anti-HLA-G (human) Monoclonal Antibody (MEM-G/1)

M01235-1 100ug
EUR 397
Description: Mouse Monoclonal HLA-G (human) Antibody (MEM-G/1). Validated in IHC, WB and tested in Human.

Human Immunoglobulin G (IgG) AssayMax ELISA Kit

EI7200-1 96 Well Plate
EUR 396

Human Cyclophilin G (PPIG) AssayMax ELISA Kit

EP6520-1 96 Well Plate
EUR 477

Mouse GNB1 shRNA Plasmid

20-abx970587
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse Guanine nucleotide-binding protein G(I)/G(S)/G(T) subunit beta-3 (GNB3) ELISA Kit

abx515474-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Mouse Gnb3/ Guanine nucleotide-binding protein G(I)/G(S)/G(T) subunit beta-3 ELISA Kit

E0608Mo 1 Kit
EUR 632

CLIA kit for Human GN?1 (G Protein Beta 1)

E-CL-H0610 1 plate of 96 wells
EUR 584
  • Gentaur's GN?1 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human GN?1 . Standards or samples are added to the micro CLIA plate wells and combined with the
  • Show more
Description: A sandwich CLIA kit for quantitative measurement of Human GN?1 (G Protein Beta 1) in samples from Serum, Plasma, Cell supernatant

ToxOut? Protein G (Sepharose) Antibody Purification Kit

K2505-1
EUR 539

mRNAExpress mRNA Synthesis kit (5 reactions)

MR-KIT-1 5 reactions
EUR 1152
  • Category: Stem Cell Products

G-Protein antagonist peptide

B6889-1 1 mg
EUR 366

Biotin Conjugated Protein G

BA1026-1 1ml
EUR 405

Peroxidase Conjugated Protein G

BA1083-1 1ml
EUR 334

FITC Conjugated Protein G

BA1121-1 1ml
EUR 304

Protein A/G Sepharose

6503-1
EUR 240

Protein A/G-FITC

6504-1
EUR 561

Protein A/G-Biotin

6506-1
EUR 512

Protein G Magnetic Beads

6517-1
EUR 262

Protein G Sepharose Column

6518-1
EUR 262

Protein A/G/L

6540-1
EUR 164

GNB1 siRNA

20-abx902219
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GNB1 Antibody

ABD9564 100 ug
EUR 438

GNB1 siRNA

20-abx918172
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GNB1 siRNA

20-abx918173
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GNB1 antibody

70R-3117 50 ug
EUR 467
Description: Rabbit polyclonal GNB1 antibody

GNB1 antibody

70R-3118 50 ug
EUR 467
Description: Rabbit polyclonal GNB1 antibody

GNB1 Antibody

35745-100ul 100ul
EUR 252

GNB1 antibody

70R-17525 50 ul
EUR 435
Description: Rabbit polyclonal GNB1 antibody

GNB1 Antibody

DF9564 200ul
EUR 304
Description: GNB1 Antibody detects endogenous levels of total GNB1.

GNB1 Antibody

1-CSB-PA897922
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against GNB1. Recognizes GNB1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

GNB1 Antibody

1-CSB-PA725644
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against GNB1. Recognizes GNB1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

GNB1 Antibody

1-CSB-PA009602GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against GNB1. Recognizes GNB1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

GNB1 Antibody

1-CSB-PA009602LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNB1. Recognizes GNB1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF; Recommended dilution: WB:1:500-1:5000, IF:1:50-1:200

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

GRO-g/CINC-2b GRO-gamma, CINC-2 beta Rat Recombinant Protein (CXCL3)

PROTQ10746-1 Regular: 10ug
EUR 317
Description: GRO-g Rat Recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 68 amino acids and having a total molecular mass of 7.8kDa. ;GRO-g is purified by proprietary chromatographic techniques. 

Gnb1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3990202 1.0 ug DNA
EUR 154

GNB1 protein (His tag)

80R-3798 50 ug
EUR 435
Description: Purified recombinant GNB1 protein (His tag)

GNB1 Recombinant Protein (Human)

RP013504 100 ug Ask for price

GNB1 Recombinant Protein (Rat)

RP202988 100 ug Ask for price

Canine IL-1 beta Recombinant Protein

R00101-1 5ug/vial
EUR 259
Description: IL-1 beta (IL-1β) is a member of the interleukin 1 family of cytokines. The IL-1 beta cytokine is produced by activated macrophages as a proprotein, which is proteolytically processed to its active form by caspase 1 (CASP1/ICE). This cytokine is an important mediator of the inflammatory response, and is involved in a variety of cellular activities, including cell proliferation, differentiation, and apoptosis. Canine IL-1 beta Recombinant Protein is purified interleukin-1 beta cytokine produced in yeast.

Equine IFN beta 1 Recombinant Protein

R02041-1 5ug/vial
EUR 259
Description: IFN beta is a mammalian Type I inferferon, functionig as a regulator of cellular activity by interacting with cell-surface receptors and activating various signaling pathways. IFN beta produces antiviral, antibacterial, and anticancer properties. Equine IFN beta Recombinant Protein is purified IFN beta produced in yeast.

Recombinant Human Heregulin Beta -1 Protein

PROTQ02297-1 50ug
EUR 317
Description: Neuregulin/Heregulin is a family of structurally related polypeptide growth factors derived from alternatively spliced genes (NRG1, NRG2, NRG3 and NRG4). To date, there are over 14 soluble and transmembrane proteins derived from the NRG1 gene. Proteolytic processing of the extracellular domain of the transmembrane NRG1 isoforms release soluble growth factors. HRG1-β1 contains an Ig domain and an EGF-like domain that is necessary for direct binding to receptor tyrosine kinases erb3 and erb4. This binding induces erb3 and erb4 heterodimerization with erb2, stimulating intrinsic kinase activity, which leads to tyrosine phosphorylation. Although HRG1-β1 biological effects is still unclear, it has been found to promote motility and invasiveness of breast cancer cells which may also involve up-regulation of expression and function of the autocrine motility-promoting factor (AMF). Recombinant human Heregulin-β1 (HRG1-β1) is a 7.5 kDa polypeptide consisting of only the EGF domain of Heregulin-β1 (65 amino acid residues).

Recombinant Rat IL-1 Beta Protein

PROTQ63264-1 10ug
EUR 317
Description: IL-1β is a proinflammatory cytokine produced in a variety of cells including monocytes, tissue macrophages, keratinocytes and other epithelial cells. Both IL-1α and IL-1β binds to the same receptor and has similar if not identical biological properties. These cytokines have a broad range of activities including, stimulation of thymocyte proliferation, by inducing IL-2 release, B-cell maturation and proliferation, mitogenic FGF-like activity and the ability to stimulate the release of prostaglandin and collagenase from synovial cells. However, whereas IL-1β is a secreted cytokine, IL-1α is predominantly a cell-associated cytokine. Recombinant rat IL-1β is a 17.4 kDa protein containing 153 amino acid residues.

IL-1-beta Interleukin-1 betaHuman Recombinant Protein

PROTP01584-1 Regular: 10ug
EUR 317
Description: Interleukin-1 beta Human Recombinant produced in E.Coli is a non-glycosylated, Polypeptide chain containing 153 amino acids and having a molecular mass of 17000 Dalton.;The IL-1b is purified by proprietary chromatographic techniques.

Mouse Protein Kinases G ELISA kit

E03P1006-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Protein Kinases G in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Protein Kinases G ELISA kit

E03P1006-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Protein Kinases G in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Protein Kinases G ELISA kit

E03P1006-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Protein Kinases G in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Protein kinase G ELISA kit

E03P1034-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Protein kinase G in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Protein kinase G ELISA kit

E03P1034-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Protein kinase G in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Protein kinase G ELISA kit

E03P1034-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Protein kinase G in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

G-749

B2213-1
EUR 131

Antagonist G

B5243-1 1 mg
EUR 340

G-749

A8889-1 1 mg
EUR 108
Description: G-749 is a selective inhibitor of Fms-like tyrosine receptor kinase-3 (FLT3) with IC50 value of 0.4 nM for wild-type FLT31.G-749 is a synthesized and ATP-competitive inhibitor of wild-type FLT3 with high potency.

Mouse Cathepsin G(cath G) ELISA kit

E03C2165-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Cathepsin G(cath G) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Cathepsin G(cath G) ELISA kit

E03C2165-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Cathepsin G(cath G) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Cathepsin G(cath G) ELISA kit

E03C2165-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Cathepsin G(cath G) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Hi-Bind? Protein G-Agarose

6513-1
EUR 234

Protein A/G Magnetic Beads

6527-1
EUR 294

Protein A/G Sepharose Column

6528-1
EUR 327

Protein A/G/L Sepharose

6541-1
EUR 311

ProMag 3 Series Protein G

PMG3N-1 1 ml
EUR 221.4
Description: ProMag 3 Series Protein Gsuitable for use in assay developmen. This item is supplied as suspension in water.

Recombinant Murine G-CSF Protein

PROTP09920-1 10ug
EUR 317
Description: G-CSF is a hematopoietic growth factor that stimulates the development of committed progenitor cells to neutrophils and enhances the functional activities of the mature end-cell. It is produced in response to specific stimulation by a variety of cells including macrophages, fibroblasts, endothelial cells and bone marrow stroma. G-CSF is being used clinically to facilitate hematopoietic recovery after bone marrow transplantation. Human and murine G-CSF are cross-species reactive. Recombinant murine G-CSF is a 19.0 kDa protein consisting of 179 amino acid residues.

ToxOut? Protein G (Sepharose) Column

M4103-1
EUR 294

Recombinant Rat G-CSF Protein

PROTP97712-1 10ug
EUR 317
Description: G-CSF is a hematopoietic growth factor that stimulates the development of committed progenitor cells to neutrophils and enhances the functional activities of the mature end-cell. It is produced in response to specific stimulation by a variety of cells including macrophages, fibroblasts, endothelial cells and bone marrow stroma. G-CSF is being used clinically to facilitate hematopoietic recovery after bone marrow transplantation. Recombinant rat G-CSF is a 21.6 kDa protein consisting of 196 amino acid residues.

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody

EXOAB-KIT-1 25 ul each
EUR 627
  • Category: Exosomes

Gnb1 ORF Vector (Mouse) (pORF)

ORF046320 1.0 ug DNA
EUR 506

Gnb1 ORF Vector (Mouse) (pORF)

ORF046321 1.0 ug DNA
EUR 506

Gnb1 ORF Vector (Mouse) (pORF)

ORF046322 1.0 ug DNA
EUR 506

Recombinant Murine MIP-1 Beta (CCL4) Protein

PROTP14097-1 10ug
EUR 317
Description: Both MIP-1α and MIP-1β are structurally and functionally related CC chemokines. They participate in the host response to invading bacterial, viral, parasite and fungal pathogens by regulating the trafficking and activation state of selected subgroups of inflammatory cells e.g. macrophages, lymphocytes and NK cells. While both MIP-1α and MIP-1β exert similar effects on monocytes their effect on lymphocytes differ; with MIP-1α selectively attracting CD8+ lymphocytes and MIP-1β selectively attracting CD4+ lymphocytes. Additionally, MIP-1α and MIP-1β have also been shown to be potent chemoattractants for B cells, eosinophils and dendritic cells. Both human and murine MIP-1α and MIP-1β are active on human and murine hematopoietic cells. Recombinant murine MIP-1β is a 7.8 kDa protein containing 69 amino acid residues, including the four highly conserved cysteine residues present in CC chemokines.

Recombinant Rat MIP-1 Beta (CCL4) Protein

PROTP50230-1 20ug
EUR 317
Description: Both MIP-1α and MIP-1β are structurally and functionally related CC chemokines. They participate in the host response to invading bacterial, viral, parasite and fungal pathogens by regulating the trafficking and activation state of selected subgroups of inflammatory cells e.g. macrophages, lymphocytes and NK cells. While both MIP-1α and MIP-1β exert similar effects on monocytes their effect on lymphocytes differ; with MIP-1α selectively attracting CD8+ lymphocytes and MIP-1β selectively attracting CD4+ lymphocytes. Additionally, MIP-1α and MIP-1β have also been shown to be potent chemoattractants for B cells, eosinophils and dendritic cells. Both human and murine MIP-1α and MIP-1β are active on human and murine hematopoietic cells. Recombinant rat MIP-1β is a 7.8 kDa protein containing 69 amino acid residues, including the four highly conserved cysteine residues present in CC chemokines.

Beta-Amyloid (1-11)

A1002-1 1 mg
EUR 102
Description: Beta-amyloid (1-11) (Abeta or A?) (C56H76N16O22) is a peptide with the sequence H-{Asp}{Ala}{Glu}{Phe}{Arg}{His}{Asp}{Ser}{Gly}{Tyr}{Glu}-OH,which is processed from the Amyloid precursor protein.

Gkap1 ELISA Kit| Mouse G kinase-anchoring protein 1 ELISA Kit

EF014994 96 Tests
EUR 689

Lyg1 ELISA Kit| Mouse Lysozyme g-like protein 1 ELISA Kit

EF015422 96 Tests
EUR 689

Gpsm1 ELISA Kit| Mouse G-protein-signaling modulator 1 ELISA Kit

EF014016 96 Tests
EUR 689

Mouse Lysozyme g- like protein 1, Lyg1 ELISA KIT

ELI-19631m 96 Tests
EUR 865

Mouse G kinase- anchoring protein 1, Gkap1 ELISA KIT

ELI-09536m 96 Tests
EUR 865

Mouse G- protein coupled receptor 1, Gpr1 ELISA KIT

ELI-27865m 96 Tests
EUR 865

Mouse G- protein- signaling modulator 1, Gpsm1 ELISA KIT

ELI-27948m 96 Tests
EUR 865

Mouse Gpsm1(G-protein-signaling modulator 1) ELISA Kit

EM1565 96T
EUR 524.1
  • Detection range: 31.2-2000 pg/ml
  • Uniprot ID: Q6IR34
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 18.75pg/ml

Mouse G Protein Signaling Modulator 1 (GPSM1) ELISA Kit

abx257546-96tests 96 tests
EUR 637
  • Shipped within 5-12 working days.

Mouse G Kinase Anchoring Protein 1 (GKAP1) ELISA Kit

abx389361-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

GNB1 Protein Vector (Mouse) (pPB-C-His)

PV185278 500 ng
EUR 603

GNB1 Protein Vector (Mouse) (pPB-N-His)

PV185279 500 ng
EUR 603

GNB1 Protein Vector (Mouse) (pPM-C-HA)

PV185280 500 ng
EUR 603

GNB1 Protein Vector (Mouse) (pPM-C-His)

PV185281 500 ng
EUR 603

GNB1 Protein Vector (Mouse) (pPB-C-His)

PV185282 500 ng
EUR 603

GNB1 Protein Vector (Mouse) (pPB-N-His)

PV185283 500 ng
EUR 603

GNB1 Protein Vector (Mouse) (pPM-C-HA)

PV185284 500 ng
EUR 603

GNB1 Protein Vector (Mouse) (pPM-C-His)

PV185285 500 ng
EUR 603

GNB1 Protein Vector (Mouse) (pPB-C-His)

PV185286 500 ng
EUR 603

GNB1 Protein Vector (Mouse) (pPB-N-His)

PV185287 500 ng
EUR 603

GNB1 Protein Vector (Mouse) (pPM-C-HA)

PV185288 500 ng
EUR 603

GNB1 Protein Vector (Mouse) (pPM-C-His)

PV185289 500 ng
EUR 603

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN300A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

Dog Guanine nucleotide-binding protein G(I)/G(S)/G(T) subunit beta-3 (GNB3) ELISA Kit

abx515472-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Rat Guanine nucleotide-binding protein G(I)/G(S)/G(T) subunit beta-3 (GNB3) ELISA Kit

abx515475-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Rat Gnb3/ Guanine nucleotide-binding protein G(I)/G(S)/G(T) subunit beta-3 ELISA Kit

E0405Ra 1 Kit
EUR 646

ELISA kit for Human Guanine nucleotide-binding protein G (I)/G (S)/G (T) subunit beta-3

EK2843 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Guanine nucleotide-binding protein G (I)/G (S)/G (T) subunit beta-3 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human GNB3/ Guanine nucleotide-binding protein G(I)/G(S)/G(T) subunit beta-3 ELISA Kit

E1027Hu 1 Kit
EUR 605

Human GNB3(Guanine nucleotide-binding protein G(I)/G(S)/G(T) subunit beta-3) ELISA Kit

EH1311 96T
EUR 567.6
  • Detection range: 0.78-50 ng/ml
  • Uniprot ID: P16520
  • Alias: GNB3(Guanine nucleotide-binding protein G(I)/G(S)/G(T) subunit beta-3)/Transducin beta chain 3
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.469 ng/ml

Human Guanine nucleotide-binding protein G(I)/G(S)/G(T) subunit beta-3 (GNB3) ELISA Kit

abx250577-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Mouse N(G),N(G)-Dimethylarginine Dimethylaminohydrolase 1 (DDAH1) ELISA Kit

RDR-DDAH1-Mu-48Tests 48 Tests
EUR 557

Mouse N(G),N(G)-Dimethylarginine Dimethylaminohydrolase 1 (DDAH1) ELISA Kit

RDR-DDAH1-Mu-96Tests 96 Tests
EUR 774

Mouse N(G),N(G)-Dimethylarginine Dimethylaminohydrolase 1 (DDAH1) ELISA Kit

RD-DDAH1-Mu-48Tests 48 Tests
EUR 533

Mouse N(G),N(G)-Dimethylarginine Dimethylaminohydrolase 1 (DDAH1) ELISA Kit

RD-DDAH1-Mu-96Tests 96 Tests
EUR 740

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN400A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

GTP-Binding Protein Fragment, G alpha

A1022-1 1 mg
EUR 90
Description: Sequence: Cys-Gly-Ala-Gly-Glu-Ser-Gly-Lys-Ser-Thr-Ile-Val-Lys-Gln-Met-LysUsing specific antisera raised against synthetic peptides, we find that three distinct GTP-binding protein alpha subunits remain bound to the plasma membrane even after activation with nonhydrolyzable GTP analog.

Protein G Coated 96-well Plates

6522-1
EUR 109

Protein A/G/L Magnetic Beads

6547-1
EUR 338

Protein A/G/L Sepharose Column

6548-1
EUR 327

ToxOut? Endotoxin-Free Protein G Sepharose

M1301-1
EUR 294

GNB1 Conjugated Antibody

C35745 100ul
EUR 397

GNB1 cloning plasmid

CSB-CL009602HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1023
  • Sequence: atgagtgagcttgaccagttacggcaggaggccgagcaacttaagaaccagattcgagacgccaggaaagcatgtgcagatgcaactctctctcagatcacaaacaacatcgacccagtgggaagaatccaaatgcgcacgaggaggacactgcgggggcacctggccaagatct
  • Show more
Description: A cloning plasmid for the GNB1 gene.

anti- GNB1 antibody

FNab03538 100µg
EUR 505.25
  • Immunogen: guanine nucleotide binding protein(G protein), beta polypeptide 1
  • Uniprot ID: P62873
  • Gene ID: 2782
  • Research Area: Signal Transduction
Description: Antibody raised against GNB1

DANRE gnb1 Antibody

abx034969-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

DANRE gnb1 Antibody

abx034969-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

GNB1 Rabbit pAb

A1867-100ul 100 ul
EUR 308

Mouse GNb1(G Protein Beta 1) ELISA Kit