Orbital Biosciences online

Ultrafiltration and Microfiltration Solutions for the Biosciences

Mouse OPTN(Optineurin) ELISA Kit

Mouse OPTN(Optineurin) ELISA Kit

Mouse Optineurin (OPTN) ELISA Kit

RD-OPTN-Mu-48Tests 48 Tests
EUR 533

Mouse Optineurin (OPTN) ELISA Kit

RD-OPTN-Mu-96Tests 96 Tests
EUR 740

Human Optineurin (OPTN) ELISA Kit

DLR-OPTN-Hu-48T 48T
EUR 517
  • Should the Human Optineurin (OPTN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Optineurin (OPTN) in samples from tissue homogenates or other biological fluids.

Human Optineurin (OPTN) ELISA Kit

DLR-OPTN-Hu-96T 96T
EUR 673
  • Should the Human Optineurin (OPTN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Optineurin (OPTN) in samples from tissue homogenates or other biological fluids.

Rat Optineurin (OPTN) ELISA Kit

DLR-OPTN-Ra-48T 48T
EUR 549
  • Should the Rat Optineurin (OPTN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Optineurin (OPTN) in samples from tissue homogenates or other biological fluids.

Rat Optineurin (OPTN) ELISA Kit

DLR-OPTN-Ra-96T 96T
EUR 718
  • Should the Rat Optineurin (OPTN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Optineurin (OPTN) in samples from tissue homogenates or other biological fluids.

Human Optineurin (OPTN) ELISA Kit

RDR-OPTN-Hu-48Tests 48 Tests
EUR 544

Human Optineurin (OPTN) ELISA Kit

RDR-OPTN-Hu-96Tests 96 Tests
EUR 756

Rat Optineurin (OPTN) ELISA Kit

RDR-OPTN-Ra-48Tests 48 Tests
EUR 583

Rat Optineurin (OPTN) ELISA Kit

RDR-OPTN-Ra-96Tests 96 Tests
EUR 811

Human Optineurin (OPTN) ELISA Kit

RD-OPTN-Hu-48Tests 48 Tests
EUR 521

Human Optineurin (OPTN) ELISA Kit

RD-OPTN-Hu-96Tests 96 Tests
EUR 723

Rat Optineurin (OPTN) ELISA Kit

RD-OPTN-Ra-48Tests 48 Tests
EUR 557

Rat Optineurin (OPTN) ELISA Kit

RD-OPTN-Ra-96Tests 96 Tests
EUR 775

Mouse Optineurin (OPTN) ELISA Kit

20-abx154488
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Optineurin, Optn ELISA KIT

ELI-43401m 96 Tests
EUR 865

Mouse Optineurin (OPTN) ELISA Kit

SEC702Mu-10x96wellstestplate 10x96-wells test plate
EUR 4862.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Optineurin (OPTN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Optineurin (OPTN) in Tissue homogenates and other biological fluids.

Mouse Optineurin (OPTN) ELISA Kit

SEC702Mu-1x48wellstestplate 1x48-wells test plate
EUR 488.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Optineurin (OPTN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Optineurin (OPTN) in Tissue homogenates and other biological fluids.

Mouse Optineurin (OPTN) ELISA Kit

SEC702Mu-1x96wellstestplate 1x96-wells test plate
EUR 654.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Optineurin (OPTN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Optineurin (OPTN) in Tissue homogenates and other biological fluids.

Mouse Optineurin (OPTN) ELISA Kit

SEC702Mu-5x96wellstestplate 5x96-wells test plate
EUR 2644.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Optineurin (OPTN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Optineurin (OPTN) in Tissue homogenates and other biological fluids.

Mouse Optineurin (OPTN) ELISA Kit

4-SEC702Mu
  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Optineurin elisa. Alternative names of the recognized antigen: NRP
  • FIP2
  • GLC1E
  • HIP7
  • HYPL
  • TFIIIA-INTP
  • Glaucoma 1, Open Angle, E(Adult-Onset)
  • Huntingtin-interacting protein 7
  • Optic neuropathy-inducing protein
  • E3-14.7K-interacting
  • Show more
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Optineurin (OPTN) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Mouse Optineurin(OPTN) ELISA Kit

QY-E21734 96T
EUR 374

ELISA kit for Mouse OPTN (Optineurin)

ELK6110 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Optineurin (OPTN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Optineurin (OPTN
  • Show more
Description: A sandwich ELISA kit for detection of Optineurin from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Mouse Optineurin (OPTN) CLIA Kit

20-abx493847
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Mouse Optineurin (OPTN) Protein

20-abx167354
  • EUR 690.00
  • EUR 286.00
  • EUR 2124.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Optineurin (OPTN) ELISA Kit

20-abx156949
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Chicken Optineurin, OPTN ELISA KIT

ELI-44363c 96 Tests
EUR 928

Rat Optineurin (OPTN) ELISA Kit

abx391748-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Optineurin, OPTN ELISA KIT

ELI-35349h 96 Tests
EUR 824

Porcine Optineurin, OPTN ELISA KIT

ELI-35350p 96 Tests
EUR 928

Human Optineurin(OPTN)ELISA Kit

QY-E01523 96T
EUR 361

Human Optineurin (OPTN) ELISA Kit

SEC702Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Optineurin (OPTN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Optineurin (OPTN) in Tissue homogenates, cell lysates and other biological fluids.

Human Optineurin (OPTN) ELISA Kit

SEC702Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Optineurin (OPTN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Optineurin (OPTN) in Tissue homogenates, cell lysates and other biological fluids.

Human Optineurin (OPTN) ELISA Kit

SEC702Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Optineurin (OPTN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Optineurin (OPTN) in Tissue homogenates, cell lysates and other biological fluids.

Human Optineurin (OPTN) ELISA Kit

SEC702Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Optineurin (OPTN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Optineurin (OPTN) in Tissue homogenates, cell lysates and other biological fluids.

Human Optineurin (OPTN) ELISA Kit

4-SEC702Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Optineurin elisa. Alternative names of the recognized antigen: NRP
  • FIP2
  • GLC1E
  • HIP7
  • HYPL
  • TFIIIA-INTP
  • Glaucoma 1, Open Angle, E(Adult-Onset)
  • Huntingtin-interacting protein 7
  • Optic neuropathy-inducing protein
  • E3-14.7K-interacting
  • Show more
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Optineurin (OPTN) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Optn ELISA Kit| Mouse Optineurin ELISA Kit

EF015752 96 Tests
EUR 689

Human Optineurin (OPTN)

1-CSB-EP016363HU
  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 69.9 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Optineurin(OPTN) expressed in E.coli

Human Optineurin (OPTN)

1-CSB-YP016363HU
  • EUR 586.00
  • EUR 299.00
  • EUR 2172.00
  • EUR 900.00
  • EUR 1442.00
  • EUR 382.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 67.9 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Optineurin(OPTN) expressed in Yeast

Optineurin (OPTN) Antibody

20-abx213783
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Optineurin (OPTN) Antibody

20-abx213784
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Optineurin (OPTN) Antibody

20-abx177863
  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Optineurin (OPTN) Antibody

20-abx114272
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Optineurin (OPTN) Antibody

20-abx129480
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Optineurin (OPTN) Antibody

abx146015-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Optineurin (OPTN) Antibody

20-abx141635
  • EUR 370.00
  • EUR 606.00
  • EUR 300.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Optineurin (OPTN) Antibody

abx029929-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Optineurin (OPTN) Antibody

abx029929-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Optineurin (OPTN) Antibody

abx235999-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Optineurin (OPTN) Antibody

abx236000-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Human Optineurin (OPTN)

1-CSB-BP016363HU
  • EUR 761.00
  • EUR 306.00
  • EUR 1951.00
  • EUR 1026.00
  • EUR 1422.00
  • EUR 431.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 67.9 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Optineurin(OPTN) expressed in Baculovirus

Optineurin (OPTN) Antibody

20-abx001525
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Recombinant Optineurin (OPTN)

4-RPC702Mu01
  • EUR 494.24
  • EUR 235.00
  • EUR 1578.40
  • EUR 592.80
  • EUR 1085.60
  • EUR 394.00
  • EUR 3796.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q8K3K8
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 38.0kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Optineurin expressed in: E.coli

ELISA kit for Human OPTN (Optineurin)

ELK5244 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Optineurin (OPTN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Optineurin (OPTN
  • Show more
Description: A sandwich ELISA kit for detection of Optineurin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Optn ELISA Kit| Rat Optineurin ELISA Kit

EF019108 96 Tests
EUR 689

OPTN ELISA Kit| chicken Optineurin ELISA Kit

EF012442 96 Tests
EUR 689

Human Optineurin (OPTN) CLIA Kit

20-abx493846
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Anti-Optineurin/OPTN Antibody

PB9343 100ug/vial
EUR 334

Optineurin (OPTN) Polyclonal Antibody (Human, Mouse)

4-PAC702Mu01
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: OPTN (Met1~Ser300)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Optineurin (OPTN)

Optineurin (OPTN) Polyclonal Antibody (Human, Mouse), APC

4-PAC702Mu01-APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: OPTN (Met1~Ser300)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Optineurin (OPTN). This antibody is labeled with APC.

Optineurin (OPTN) Polyclonal Antibody (Human, Mouse), Biotinylated

4-PAC702Mu01-Biotin
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: OPTN (Met1~Ser300)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Optineurin (OPTN). This antibody is labeled with Biotin.

Optineurin (OPTN) Polyclonal Antibody (Human, Mouse), Cy3

4-PAC702Mu01-Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: OPTN (Met1~Ser300)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Optineurin (OPTN). This antibody is labeled with Cy3.

Optineurin (OPTN) Polyclonal Antibody (Human, Mouse), FITC

4-PAC702Mu01-FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: OPTN (Met1~Ser300)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Optineurin (OPTN). This antibody is labeled with FITC.

Optineurin (OPTN) Polyclonal Antibody (Human, Mouse), HRP

4-PAC702Mu01-HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: OPTN (Met1~Ser300)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Optineurin (OPTN). This antibody is labeled with HRP.

Optineurin (OPTN) Polyclonal Antibody (Human, Mouse), PE

4-PAC702Mu01-PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: OPTN (Met1~Ser300)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Optineurin (OPTN). This antibody is labeled with PE.

Polyclonal OPTN / Optineurin Antibody (aa115-130)

AMM06916G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human OPTN / Optineurin (aa115-130). This antibody is tested and proven to work in the following applications:

Polyclonal OPTN / Optineurin Antibody (aa559-575)

AMM06917G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human OPTN / Optineurin (aa559-575). This antibody is tested and proven to work in the following applications:

Anti-Optineurin/OPTN Antibody (monoclonal, 3D8)

M00952 100ug/vial
EUR 294

Optineurin (OPTN) Polyclonal Antibody (Human, Mouse), APC-Cy7

4-PAC702Mu01-APC-Cy7
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: OPTN (Met1~Ser300)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Optineurin (OPTN). This antibody is labeled with APC-Cy7.

Mouse Optineurin ELISA kit

E03O0025-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Optineurin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Optineurin ELISA kit

E03O0025-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Optineurin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Optineurin ELISA kit

E03O0025-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Optineurin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Recombinant Human Optineurin/ OPTN Protein, His, Yeast-100ug

QP9317-ye-100ug 100ug
EUR 670

Recombinant Human Optineurin/ OPTN Protein, His, Yeast-10ug

QP9317-ye-10ug 10ug
EUR 308

Recombinant Human Optineurin/ OPTN Protein, His, Yeast-1mg

QP9317-ye-1mg 1mg
EUR 2747

Recombinant Human Optineurin/ OPTN Protein, His, Yeast-200ug

QP9317-ye-200ug 200ug
EUR 1069

Recombinant Human Optineurin/ OPTN Protein, His, Yeast-500ug

QP9317-ye-500ug 500ug
EUR 1804

Recombinant Human Optineurin/ OPTN Protein, His, Yeast-50ug

QP9317-ye-50ug 50ug
EUR 417

Optn/ Rat Optn ELISA Kit

ELI-35351r 96 Tests
EUR 886

OPTN ELISA Kit (Mouse) (OKCD08230)

OKCD08230 96 Wells
EUR 1001
Description: Description of target: Plays an important role in the maintenance of the golgi complex, in membrane trafficking, in exocytosis, through its interaction with myosin vi and rab8. links myosin vi to the golgi complex and plays an important role in golgi ribbon formation. negatively regulates the induction of ifnb in response to rna virus infection. plays a neuroprotective role in the eye and optic nerve. probably part of the tnf-alpha signaling pathway that can shift the equilibrium toward induction of cell death. may act by regulating membrane trafficking and cellular morphogenesis via a complex that contains rab8 and hungtingtin (hd). mediates the interaction of rab8 with the probable gtpase-activating protein tbc1d17 during rab8-mediated endocytic trafficking, such as of transferrin receptor (tfrc/tfr); regulates rab8 recruitnment to tubules emanating from the endocytic recycling compartment. autophagy receptor that interacts directly with both the cargo to become degraded and an autophagy modifier of the map1 lc3 family; targets ubiquitin-coated bacteria (xenophagy) and appears to function in the same pathway as sqstm1 and calcoco2/ndp52 (by similarity).;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 0.063ng/mL

OPTN ELISA Kit (Mouse) (OKDD00656)

OKDD00656 96 Wells
EUR 988
Description: Description of target: Plays an important role in the maintenance of the golgi complex, in membrane trafficking, in exocytosis, through its interaction with myosin vi and rab8. links myosin vi to the golgi complex and plays an important role in golgi ribbon formation. negatively regulates the induction of ifnb in response to rna virus infection. plays a neuroprotective role in the eye and optic nerve. probably part of the tnf-alpha signaling pathway that can shift the equilibrium toward induction of cell death. may act by regulating membrane trafficking and cellular morphogenesis via a complex that contains rab8 and hungtingtin (hd). mediates the interaction of rab8 with the probable gtpase-activating protein tbc1d17 during rab8-mediated endocytic trafficking, such as of transferrin receptor (tfrc/tfr); regulates rab8 recruitnment to tubules emanating from the endocytic recycling compartment. autophagy receptor that interacts directly with both the cargo to become degraded and an autophagy modifier of the map1 lc3 family; targets ubiquitin-coated bacteria (xenophagy) and appears to function in the same pathway as sqstm1 and calcoco2/ndp52 (by similarity).;Species reactivity: Mouse;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: <0.051 ng/mL

Rat Optineurin ELISA kit

E02O0025-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Optineurin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Optineurin ELISA kit

E02O0025-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Optineurin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Optineurin ELISA kit

E02O0025-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Optineurin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Optineurin ELISA kit

E01O0025-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Optineurin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Optineurin ELISA kit

E01O0025-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Optineurin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Optineurin ELISA kit

E01O0025-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Optineurin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Optineurin ELISA kit

E04O0025-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Optineurin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Optineurin ELISA kit

E04O0025-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Optineurin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Optineurin ELISA kit

E04O0025-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Optineurin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Optineurin ELISA kit

E08O0025-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Optineurin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Optineurin ELISA kit

E08O0025-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Optineurin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Optineurin ELISA kit

E08O0025-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Optineurin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Optineurin ELISA kit

E07O0025-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Optineurin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Optineurin ELISA kit

E07O0025-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Optineurin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Optineurin ELISA kit

E07O0025-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Optineurin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Optineurin ELISA kit

E06O0025-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Optineurin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Optineurin ELISA kit

E06O0025-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Optineurin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Optineurin ELISA kit

E06O0025-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Optineurin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Optineurin ELISA kit

E09O0025-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Optineurin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Optineurin ELISA kit

E09O0025-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Optineurin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Optineurin ELISA kit

E09O0025-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Optineurin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

OPTN ELISA KIT|Human

EF001443 96 Tests
EUR 689

Guinea pig Optineurin ELISA kit

E05O0025-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Optineurin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Optineurin ELISA kit

E05O0025-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Optineurin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Optineurin ELISA kit

E05O0025-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Optineurin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

OPTN ELISA Kit (Human) (OKCD01694)

OKCD01694 96 Wells
EUR 831
Description: Description of target: Plays an important role in the maintenance of the Golgi complex, in membrane trafficking, in exocytosis, through its interaction with myosin VI and Rab8. Links myosin VI to the Golgi complex and plays an important role in Golgi ribbon formation. Negatively regulates the induction of IFNB in response to RNA virus infection. Plays a neuroprotective role in the eye and optic nerve. Probably part of the TNF-alpha signaling pathway that can shift the equilibrium toward induction of cell death. May act by regulating membrane trafficking and cellular morphogenesis via a complex that contains Rab8 and hungtingtin (HD). Mediates the interaction of Rab8 with the probable GTPase-activating protein TBC1D17 during Rab8-mediated endocytic trafficking, such as of transferrin receptor (TFRC/TfR); regulates Rab8 recruitnment to tubules emanating from the endocytic recycling compartment. Autophagy receptor that interacts directly with both the cargo to become degraded and an autophagy modifier of the MAP1 LC3 family; targets ubiquitin-coated bacteria (xenophagy), such as cytoplasmic Salmonella enterica, and appears to function in the same pathway as SQSTM1 and CALCOCO2/NDP52. May constitute a cellular target for adenovirus E3 14.7, an inhibitor of TNF-alpha functions, thereby affecting cell death.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.061 ng/mL

OPTN ELISA Kit (Human) (OKEH08383)

OKEH08383 96 Wells
EUR 896
Description: Description of target: This gene encodes the coiled-coil containing protein optineurin. Optineurin may play a role in normal-tension glaucoma and adult-onset primary open angle glaucoma. Optineurin interacts with adenovirus E3-14.7K protein and may utilize tumor necrosis factor-alpha or Fas-ligand pathways to mediate apoptosis, inflammation or vasoconstriction. Optineurin may also function in cellular morphogenesis and membrane trafficking, vesicle trafficking, and transcription activation through its interactions with the RAB8, huntingtin, and transcription factor IIIA proteins. Alternative splicing results in multiple transcript variants encoding the same protein.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.163ng/mL

Optineurin antibody

70R-2621 50 ug
EUR 467
Description: Rabbit polyclonal Optineurin antibody raised against the C terminal of OPTN

anti-Optineurin

YF-PA16727 50 ul
EUR 363
Description: Mouse polyclonal to Optineurin

anti-Optineurin

YF-PA16728 50 ug
EUR 363
Description: Mouse polyclonal to Optineurin

anti-Optineurin

YF-PA16729 100 ul
EUR 403
Description: Rabbit polyclonal to Optineurin

anti-Optineurin

YF-PA16730 100 ug
EUR 403
Description: Rabbit polyclonal to Optineurin

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

Mouse OPTN shRNA Plasmid

20-abx977443
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

OPTN Recombinant Protein (Mouse)

RP159389 100 ug Ask for price

OPTN antibody

70R-19048 50 ul
EUR 435
Description: Rabbit polyclonal OPTN antibody

OPTN Antibody

32466-100ul 100ul
EUR 252

OPTN Antibody

1-CSB-PA924414
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against OPTN. Recognizes OPTN from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100

OPTN Antibody

DF6655 200ul
EUR 304
Description: OPTN Antibody detects endogenous levels of total OPTN.

OPTN Antibody

1-CSB-PA548038
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against OPTN. Recognizes OPTN from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100

OPTN Antibody

1-CSB-PA016363GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against OPTN. Recognizes OPTN from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

OPTN siRNA

20-abx903762
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

OPTN siRNA

20-abx926984
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

OPTN siRNA

20-abx926985
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

OPTN Antibody

ABD6655 100 ug
EUR 438

Optineurin Blocking Peptide

33R-8367 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of OPTN antibody, catalog no. 70R-2621

Anti-Optineurin antibody

STJ13100209 100 µl
EUR 427

Optn ORF Vector (Mouse) (pORF)

ORF053131 1.0 ug DNA
EUR 506

OPTN Blocking Peptide

DF6655-BP 1mg
EUR 195

OPTN Conjugated Antibody

C32466 100ul
EUR 397

OPTN cloning plasmid

CSB-CL016363HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1734
  • Sequence: atgtcccatcaacctctcagctgcctcactgaaaaggaggacagccccagtgaaagcacaggaaatggacccccccacctggcccacccaaacctggacacgtttaccccggaggagctgctgcagcagatgaaagagctcctgaccgagaaccaccagctgaaagaagccatga
  • Show more
Description: A cloning plasmid for the OPTN gene.

OPTN cloning plasmid

CSB-CL016363HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1716
  • Sequence: atgtcccatcaacctctcagctgcctcactgaaaaggaggacagccccagtgaaagcacaggaaatggacccccccacctggcccacccaaacctggacacgtttaccccggaggagctgctgcagcagatgaaagagctcctgaccgagaaccaccagctgaaagaagccatga
  • Show more
Description: A cloning plasmid for the OPTN gene.

OPTN Rabbit pAb

A1845-100ul 100 ul
EUR 308

OPTN Rabbit pAb

A1845-200ul 200 ul
EUR 459

OPTN Rabbit pAb

A1845-20ul 20 ul
EUR 183

OPTN Rabbit pAb

A1845-50ul 50 ul
EUR 223

anti- OPTN antibody

FNab05999 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:2000
  • IP:1:500-1:1000
  • IHC: 1:50-1:500
  • IF: 1:10-1:100
  • Immunogen: optineurin
  • Uniprot ID: Q96CV9
  • Gene ID: 10133
  • Research Area: Neuroscience, Immunology, Signal Transduction
Description: Antibody raised against OPTN

anti- OPTN antibody

FNab06000 100µg
EUR 585
  • Recommended dilution: WB: 1:500-1:2000
  • IHC: 1:50-1:500
  • IF: 1:50-1:500
  • Immunogen: optineurin
  • Uniprot ID: Q96CV9
  • Gene ID: 10133
  • Research Area: Neuroscience, Immunology, Signal Transduction
Description: Antibody raised against OPTN

Anti-OPTN antibody

PAab05999 100 ug
EUR 355

Anti-OPTN antibody

STJ24869 100 µl
EUR 277
Description: This gene encodes the coiled-coil containing protein optineurin. Optineurin may play a role in normal-tension glaucoma and adult-onset primary open angle glaucoma. Optineurin interacts with adenovirus E3-14.7K protein and may utilize tumor necrosis factor-alpha or Fas-ligand pathways to mediate apoptosis, inflammation or vasoconstriction. Optineurin may also function in cellular morphogenesis and membrane trafficking, vesicle trafficking, and transcription activation through its interactions with the RAB8, huntingtin, and transcription factor IIIA proteins. Alternative splicing results in multiple transcript variants encoding the same protein.

Anti-OPTN Antibody

STJ501367 100 µg
EUR 476

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Optn sgRNA CRISPR Lentivector set (Mouse)

K5015501 3 x 1.0 ug
EUR 339

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

Rat OPTN shRNA Plasmid

20-abx987977
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human OPTN shRNA Plasmid

20-abx956834
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

pCMV-SPORT6-OPTN Plasmid

PVT16656 2 ug
EUR 325

pCMV-SPORT6-OPTN Plasmid

PVT17057 2 ug
EUR 325

OPTN Recombinant Protein (Human)

RP022147 100 ug Ask for price

OPTN Recombinant Protein (Human)

RP022150 100 ug Ask for price

OPTN Recombinant Protein (Rat)

RP218828 100 ug Ask for price

Anti-OPTN Antibody (Biotin)

STJ501368 100 µg
EUR 586

Anti-OPTN Antibody (FITC)

STJ501369 100 µg
EUR 586

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

Optn sgRNA CRISPR Lentivector (Mouse) (Target 1)

K5015502 1.0 ug DNA
EUR 154

Optn sgRNA CRISPR Lentivector (Mouse) (Target 2)

K5015503 1.0 ug DNA
EUR 154

Optn sgRNA CRISPR Lentivector (Mouse) (Target 3)

K5015504 1.0 ug DNA
EUR 154

OPTN Protein Vector (Mouse) (pPB-C-His)

PV212522 500 ng
EUR 603

OPTN Protein Vector (Mouse) (pPB-N-His)

PV212523 500 ng
EUR 603

OPTN Protein Vector (Mouse) (pPM-C-HA)

PV212524 500 ng
EUR 603

OPTN Protein Vector (Mouse) (pPM-C-His)

PV212525 500 ng
EUR 603

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV100PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV105PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV120PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV125PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS700A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS720A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS740A-KIT 10 rxn
EUR 1132
  • Category: Cas9

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV200PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV205PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV220PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV225PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS750A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS770A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS790A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]

CAS9LIG-KIT 1 Kit
EUR 153
  • Category: Cas9

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

Optn ORF Vector (Rat) (pORF)

ORF072944 1.0 ug DNA
EUR 506

OPTN ORF Vector (Human) (pORF)

ORF007383 1.0 ug DNA
EUR 95

OPTN ORF Vector (Human) (pORF)

ORF007384 1.0 ug DNA
EUR 95

AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE620A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE622A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE624A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

vWF Acty. Kit

ABP-ACT-KIT 12 x 8 microwells
EUR 428

vWF Ant. Kit

ABP-TOT-KIT 12 x 8 microwells
EUR 394

Optn sgRNA CRISPR Lentivector set (Rat)

K7332801 3 x 1.0 ug
EUR 339

OPTN sgRNA CRISPR Lentivector set (Human)

K1485601 3 x 1.0 ug
EUR 339

hspCas9 AAVS1 Safe Harbor Knock-in Donor (AAVS1-SA-puro-EF1-hspCas9)

CAS620A-KIT 1 kit
EUR 2152
  • Category: Cas9
Description: Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector), CAS640PR-1 (Junction PCR Primer Mix to confirm Cas9 integration site), and CAS9-PR-1 (PCR primers to confirm Cas9 expression)

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN300A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN400A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN410A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN412A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

PrecisionX Multiplex gRNA Cloning Kit

CAS9-GRNA-KIT 10 rxn
EUR 445
  • Category: Cas9

mRNAExpress mRNA Synthesis kit (5 reactions)

MR-KIT-1 5 reactions
EUR 1152
  • Category: Stem Cell Products

Optn sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K5015505 3 x 1.0 ug
EUR 376

Optn sgRNA CRISPR Lentivector (Rat) (Target 1)

K7332802 1.0 ug DNA
EUR 154

Optn sgRNA CRISPR Lentivector (Rat) (Target 2)

K7332803 1.0 ug DNA
EUR 154

Optn sgRNA CRISPR Lentivector (Rat) (Target 3)

K7332804 1.0 ug DNA
EUR 154

OPTN sgRNA CRISPR Lentivector (Human) (Target 1)

K1485602 1.0 ug DNA
EUR 154

OPTN sgRNA CRISPR Lentivector (Human) (Target 2)

K1485603 1.0 ug DNA
EUR 154

OPTN sgRNA CRISPR Lentivector (Human) (Target 3)

K1485604 1.0 ug DNA
EUR 154

OPTN Protein Vector (Rat) (pPB-C-His)

PV291774 500 ng
EUR 603

OPTN Protein Vector (Rat) (pPB-N-His)

PV291775 500 ng
EUR 603

OPTN Protein Vector (Rat) (pPM-C-HA)

PV291776 500 ng
EUR 603

OPTN Protein Vector (Rat) (pPM-C-His)

PV291777 500 ng
EUR 603

OPTN Protein Vector (Human) (pPB-C-His)

PV029529 500 ng
EUR 329

OPTN Protein Vector (Human) (pPB-N-His)

PV029530 500 ng
EUR 329

OPTN Protein Vector (Human) (pPM-C-HA)

PV029531 500 ng
EUR 329

OPTN Protein Vector (Human) (pPM-C-His)

PV029532 500 ng
EUR 329

OPTN Protein Vector (Human) (pPB-C-His)

PV029533 500 ng
EUR 329

OPTN Protein Vector (Human) (pPB-N-His)

PV029534 500 ng
EUR 329

OPTN Protein Vector (Human) (pPM-C-HA)

PV029535 500 ng
EUR 329

OPTN Protein Vector (Human) (pPM-C-His)

PV029536 500 ng
EUR 329

Optn 3'UTR Luciferase Stable Cell Line

TU115713 1.0 ml Ask for price

Optn 3'UTR GFP Stable Cell Line

TU165713 1.0 ml Ask for price

Mouse OPTN(Optineurin) ELISA Kit